Rats didn’t exist before that time! Here’s a cool paper on ERVs potentially influencing mammalian placental development:
There were no rats that existed at a certain point in time and you don’t get rats until you have the development early on in mammalian lineages of the placenta.
There would be some kind of original placental mammal as described here (as in well before rats, humans, etc.):
http://science.sciencemag.org/content/339/6120/662.full
@outrigger, just in case what @pevaquark wrote seems confusing… he used the term “it”.
What the sentence intends: “Rats didn’t exist before that time!”
Hope that helps.
Chimps share more DNA with humans than they do any other species. The scientific consensus is that chimps are more closely related to humans than any other species.
Also, there is no reason why similar morphology should correlate with similar genetics. Only a tiny portion of the genome actually influences morphology, yet it is the whole genome that is similar. You can also get very similar morphology with very different genetic sequences. There is absolutely no reason that a designer would have to keep the human genome >95% similar to chimps in order to have similar morphology.
There are vehicles that are very different from one another, and vehicles don’t fit into a nested hierarchy.
What are the shared derived features that you are using to construct your phylogeny? What are the synapomorphies? What are the apomorphies?
That is what I am saying. I don’t have the specific examples at hand, but some of them were analyzed in the following paper:
You will see that the 5’ and 3’ LTRs (5’ is on the left and 3’ on the right) are the most divergent and are on divergent trees. This is exactly what we would expect if evolution is true, but design can’t explain it. There is more similarity between orthologous 5’ LTRs in different species than there are between the 5’ and 3’ LTRs of an ERV in a single species.
Because the majority of those differences are substitution mutations so it is easy to determine orthologous positions. If 1 out of 50 bases is switched for a different base it isn’t that hard to line up the genomes and see if they are in the same spot. For the following example I will have the ERV sequence in bold and the one mutation 7 bases in:
AGTCTAGGTATACCGTATTATTATTTTAAATAATTATTATT
AGTCTAAGTATACCGTATTATTATTTTAAATAATTATTATT
There is 1 mutation in 41 bases, so an overall difference of 2.4%. Do you have any problems seeing that the ERV starts at the same base?
It was also only a theory that mammal ancestors had to have a specific gene in order to survive.
Another important term is synteny:
“In classical genetics, synteny describes the physical co-localization of genetic loci on the same chromosome within an individual or species. Today, however, biologists usually refer to synteny as the conservation of blocks of order within two sets of chromosomes that are being compared with each other. This concept can also be referred to as shared synteny.”
Synteny for the Chief Wikipedia Quoter
For closely related species you should see a lot of synteny for orthologous genes. With a recent common ancestor there are very few major recombination events that break up the physical relationships between genes. Paralogs usually lack synteny because they are produced by a gene duplication and result in a gene “out of order” with the other genes around it. As evolutionary distance increases it is more and more difficult to see how genes have moved around due to recombination events, so that is why a less specific term of homologous is used at times.
no according to many scientists in the field (see project encode for instance).
[quote=“T_aquaticus, post:63, topic:38700”]
There are vehicles that are very different from one another[/quote]
but many of them indeed similar. is it because a common descent or a common designer? the answer is clear.
see here:
its not so clear as you may think. from the paper:
“The remaining trees displayed interesting deviations from the predicted separation of the 5′ and 3′ LTR sequences.” and: “The HERV-K(C4) LTR sequences (Fig. 2C) give the predicted topology; however, as noted previously (15, 16), the provirus was missing altogether from gorilla and chimpanzee DNA,” and: "
secondly: these cases can be indeed a real insertions, but they are the minority and not the majority (unless you can show otherwise).
no problem. and again: the example of 6 ervs above is also about tiny spot in the genome (1\10000). far from a random insertion.
see my car example. we cant make a car stepwise when every step can be functional. so what make we think that its possible with a living creature in this case? think about this erv as a fuel. how we can get into a car that nneed a fuel from a car that doesnt need?
Nowhere in any of their work do they show which parts of the genome influence morphology. Just because a stretch of DNA is transcribed into RNA does not mean it influences morphology. For example, how do introns influence morphology? How does cytochrome c influence morphology?
I can find cars that are bigger than trucks, cars with bigger tires than both vans and trucks, cars with mudflaps and trucks without mudflaps . . . your phylogeny fails rather spectacularly.
Design doesn’t explain any of that, as shown by the absence of any coherent explanation for those observations.
None of those were shown to be at the same base, so I don’t understand why you keep bringing them up. Any observed bias towards non-random insertion is not enough to cause 99.9% of insertions to occur at the same base for independent insertions. Out of the nearly 300 PtERV insertions they looked at only a handful were even within a few hundred thousand bases of each other. 99.9% of human ERVs are found at the orthologous base in the chimp genome.
Are you saying that there is no living species that lacks syncytin, because that would be wrong.
My apologies for jumping into this thread so late, I’ll have to catch up later on the conversation. Occasionally @Barry_Desborough pops in to mention his take on ERVs. He has a pretty good faq-based site (here) on the topic.
but in most cases we dont find this.
i just showed you a counter example. here it again:
“The remaining trees displayed interesting deviations from the predicted separation of the 5′ and 3′ LTR sequences.” and: “The HERV-K(C4) LTR sequences (Fig. 2C) give the predicted topology; however, as noted previously (15, 16), the provirus was missing altogether from gorilla and chimpanzee DNA,” and: "
first: where is the reference for this claim? second: if retroviruses evolved from host parts then it can exaplin why so many ervs are in the same spot (under the design scanario).
no. i just saying that a creature without an erv can evolve into a creature with an erv if it cant survive without it.
Until you can explain the lack of placental mammals on Australia (with the exception of bats that can fly, and the recent arrivals within the last 50,000 years: humans, their dogs, 20th century rabbits, etc.) - - you shouldn’t be allowed to drive any “cars”…
you mean like this one?:
So you are claiming that somehow a virus evolved in the DNA of a host and then somehow got out to infect other hosts?
I might be misunderstanding this but it appears you are saying that a creature without an ERV could evolve into a creature with an ERV if the ERV was necessary for it’s survival? But how does the creature without the ERV survive in the first place? If a new trait is needed for survival it has to be in place before the need for survival occurs. Otherwise it isn’t able to survive the change.
Interesting article, thanks for posting. I loved the little tidbit it contained:"Amazingly, each Australian currently uses as much energy as five sperm whales. "
Who knew that sperm whales were so “green.”
HA! You post a link from 1998!?
… and you think it even says what you think it says? Did you actually read it?
How about THIS article below! … which even if you are skeptical about the key placental link from South America to Australia, the article compares three very diverse “kinds” of Australia’s fauna and concludes that they are unusually closely related, genetically, despite the distinct “kinds” of animals they represent:
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
This post is just to provide the separate link of the study mentioned above:
“Tracking Marsupial Evolution Using Archaic Genomic Retroposon Insertions” by Maria A. Nilsson, Gennady Churakov, Mirjam Sommer, Ngoc Van Tran, Anja Zemann, Jürgen Brosius, and Jürgen Schmitz
PLoS Biol. 2010 Jul; 8(7): e1000436. Published online 2010 Jul 27. PMCID: PMC2910653 PMID: 20668664
Notice in the image below, the various branches associated only with South America, and branches associated with Australia, where “radiating” speciation continued, in isolation from the rest of the world.
[Be sure to click on the images to enlarge text to a more convenient font size!]
While at the top we have “shrew-like” forms, and at the bottom we have “kanga” forms aggregated, in the middle grouping, we have the suggestion that three very distinct groupings share a close heritage:
Dasyuromorphia: the group having most of Australia’s carnivorous marsupials, including
quolls,
dunnarts,
the numbat,
the Tasmanian devil,
and the thylacine.
[In Australia, the exceptions include the marsupial moles and the omnivorous bandicoots.]
Notoryctemorphia: moles, vegetarian
Peremelamorphia: bandicoots & bilbies “the characteristic bandicoot shape: a plump, arch-backed body with a long, delicately tapering snout, very large upright ears, relatively long, thin legs, and a thin tail. Their size varies from about 140 grams up to 4 kilograms, but most species are about one kilogram, or the weight of a half-grown kitten [4 kilograms = 4 half-grown kittens].”
.
.
.
So we should be careful of a few things here.
Concerning though Ausktribosphenos the author notes:
Similarly, eutherian affinities were suggested for the Australian Early Cretaceous mammals Ausktribosphenos and Bishops (Rich et al. 1997, 1999, 2001a), but this view has not been widely accepted; for example, see Kielan-Jaworowska et al. (1998), but also see the reply by Rich et al. (1998), and Musser and Archer (1998), Archer et al. (1999), and Luo, Cifelli, and Kielan-Jaworowska (2001a). See also further criticism by Luo et al. (2002), Kielan-Jaworowska et al. (2004), and chapter 6 (in this volume). An early presence of Eutheria in Asia, coupled with the fact that eutherians were the dominant therians in the Late Cretaceous faunas on that continent, led to the view that they arose in Asia, later spreading to North America and elsewhere (Kielan-Jaworowska 1982).
And the final summary:
The existence of so many conflicting ideas on the nature of Gondwanan mammals with tribosphenic molars has its source, no doubt, in the lack of adequate fossil material. One should remember that Ausktribosphenos, Bishops, Ambondro, and Asfalotomylos, even after decades of prospecting, are known only from incomplete dentaries with partial dentitions. Tom Rich informed me recently (March 2010) that he found the first upper tooth – possibly the third premolar (P3) – of an ausktribosphenidan mammal at the locality Flat Rocks yielding lower dentitions in Australia. Fossil monotremes older than Oligocene are represented only by two isolated Paleocene molars from Argentina and a single dentary fragment with three teeth of Early Cretaceous from Australia, plus one molar with a dentary fragment (Teinolophos) from Australia. As long as the phylogeny of these early mammals is to be based on incomplete dentaries and fragments of the lower dentition, all the discussed views have to remain in the sphere of preliminary hypotheses.
All you need is a few cases for your cladogram to fail. Designed things don’t fit into nested hierarchies because designers are not forced to design in such a way. Designers mix and match parts from many designs without needing to form phylogenies. Intelligent design can’t explain the observed phylogeny in biology. Evolution can.
How does design explain those patterns?
" Based on an analysis of 1,467 large-insert clones, we mapped 299 retroviral insertion sites among the four species (Figure 3; Table S2). A total of 275 of the insertion sites mapped unambiguously to non-orthologous locations (Table 2), indicating that the vast majority of elements were lineage-specific (i.e., they emerged after the divergence of gorilla/chimpanzee and macaque/baboon from their common ancestor)."
Lineage-Specific Expansions of Retroviral Insertions within the Genomes of African Great Apes but Not Humans and Orangutans
ERVs didn’t evolve from host parts. ERVs are virus parts. We can directly observe viruses creating new ERVs right in the lab.
You would need to show that none of the rat ancestors could live without syncytin if you are going to make this claim.
This is an EXCELLENTLY worded observation !
Designers design, but they don’t worry about following nested hierarchies… only Evolution is thusly limited!
More to the point, when humans design organisms they regularly violate a nested hierarchy. There are thousands of cases of humans taking a gene from one species and putting it into a very different species, and in doing so create very obvious violations of a nested hierarchy.
@outrigger, do you believe the assertion in the article that states that the fossil is about 120mya?
“Let your conversation be always full of grace, seasoned with salt, so that you may know how to answer everyone.” -Colossians 4:6
This is a place for gracious dialogue about science and faith. Please read our FAQ/Guidelines before posting.
