So how are the facts embedded in the conclusions?
In the science I practice, facts are used to test hypotheses and conclusions.
Just as there are Flat and Globe Earthers.
What scientists are saying science provides all answers?
2 Likes
I liked T_aquaticus response to Marc because he was right to challenge Marc’s use of the word “fact.” But I liked RichardG response to this, because like him I am not so comfortable with the claim that this distinction between fact and conclusion is so clear cut. And yet he uses this same distinction to suggest that conclusions are less than facts. Obviously the reasons for his objection are very different from mine.
My understanding/emphasis in the defining nature of science is the 2 methodological principles: the honesty of testing hypotheses rather than trying to prove them and the objectivity of conclusions based on written procedures which give the same result no matter who follows them. The problem with creationists is their refusal to understand this nature of science, insisting that proving your conclusions as used by preachers, politicians, and used car salesmen is the only methodology of getting at the truth.
I also don’t buy into the notion that knowledge is what has been proven. Too much of proof rests on premises which can be discarded later. Instead I think knowledge consists of the beliefs we live by. These include scientific conclusions which have become part of the tools by which we make scientific investigations. If by “facts” T_Aquaticus means those objective results I describe above that is a clear distinction. But I would include conclusions in the body of scientific knowledge as what should be consider fact.
1 Like
You (science) was looking for confirmation. You saw what you wanted.
Richard
Such as?
For example, here is a comparison of orthologous chimp and human DNA:
102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584
>>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>>
098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896
102836585 ttctccacttgcttggaaactctcatcacctatttctttcttccccaaaa 102836634
>>>>>>>>> ||||||||||||||||||||||| |||||||||||||||||||||||||| >>>>>>>>>
098675897 ttctccacttgcttggaaactctaatcacctatttctttcttccccaaaa 098675946
102836635 atcctcctcccttttccctgcattgcagcctaggaagcacagcaactatt 102836684
>>>>>>>>> |||||||||||||||||||||||||||| ||||||||||||||||||||| >>>>>>>>>
098675947 atcctcctcccttttccctgcattgcagtctaggaagcacagcaactatt 098675996
102836685 tcaaaacaccaggggaccctttagtgctctgcaaacatggtgatcaggtt 102836734
>>>>>>>>> ||||||||||| ||||||||||||||||||||||||||||||||||||| >>>>>>>>>
098675997 tcaaaacaccacaggaccctttagtgctctgcaaacatggtgatcaggtt 098676046
102836735 acctttcaataaagatcatcagcctccacttccttaccttgagtagaaaa 102836784
>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
098676047 acctttcaataaagatcatcagcctccacttccttaccttgagtagaaaa 098676096
102836785 caaaatctttttttttttttaaactttgggcacatggaaaggtaagtatt 102836834
>>>>>>>>> |||||||||||||||||| || ||||||||||||||||||||||||||| >>>>>>>>>
098676097 caaaatctttttttttttata--ctttgggcacatggaaaggtaagtatt 098676144
102836835 tgcaaatgactggcatgggcaatgactgacaactcaggaaagacagacaa 102836884
>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||| ||| >>>>>>>>>
098676145 tgcaaatgactggcatgggcaatgactgacaactcaggaaagacaggcaa 098676194
102836885 aaaatctccctgggaattagtagcagcaataagatagggtggaggagaag 102836934
>>>>>>>>> ||||||||||||||| |||||||||||||||||||||||||||||||||| >>>>>>>>>
098676195 aaaatctccctgggagttagtagcagcaataagatagggtggaggagaag 098676244Am I just seeing differences because I want there to be differences between the genomes? If you sequenced these genomes do you think you would get a different result?
2 Likes
Do not try and blind me with graphs and figures. It is not the figures I query just the use of them and the extrapolations from them.
Connectivity does not prove ancestry It proves structure, nothing more.
Richard
It is the figures you are querying. The figures are the facts. They are the data. You are claiming that we are just seeing things and not seeing actual facts which would make those figures nothing but fantasy in your world. So where is your evidence that all of this data is just made up? Are the sequences I showed you just made up?
That doesn’t mean anything.
It seems that in your attempt to discount scientific conclusions you are willing to ignore facts. That doesn’t seem like a good way of approaching reality.
2 Likes
As a software developer who spends a lot of time reviewing the output of git diff, I can assure you that that statement is complete and utter baloney.
(For anyone who has never used git diff, it’s like comparative genomics, but for computer code. Both work using exactly the same principles.)
4 Likes
Dear Aquaticus. I love your name, but I hope you are not a mearman … or a mermaid.
To your reply. Thank you for the effort, but it seems I was unable to convey clearly enough the sarcasm in my examples.
All I did was to give false “facts” to illustrate how people use what is useful to reinforce a forgone conclusion. Everyone has an opinion. True. Everyone wants to collect acolytes that think the same way. We are a gregarious species after all. The technical term is confirmation bias.
Lets see a definition of facts vs conclusions.
"Facts are things that are objectively true and typically can be verified. Opinions are thoughts people have about the facts. *Conclusions are logical derivations from the facts
So it is clear from the above, that opinions and conclusions are directly derived from the so called facts.
If scientific “consensus”, or religious bigotry, produces a false fact, all that derives from them is also false. Rather obvious.
The SDA church preaches that veganism is the diet that God wants us to follow. And to under pin it, they state matter of fact the commandment … you shall not kill.
Who can deny that?
There are thousands if not millions of false “facts” that humans have adopted as true for milenia.
By ignorance, by omission, bias, protecting agenda or interests, you name it, that is man’s history.
So, to my previous statement.
All is relative and also subjective.
When you could cite the laws of physics and tell me they are not subjective since if I jump I will come down, every thing we experience in our life is the result of wat comes in true senses, how it is processed in our brain, and what the brain tells us actually happened.
What I see as colour red, is not what you see as red. Or rather I have no way to tell what you see, and you can not tell what I see.
So when we become dogmatic and try to define all we see as “facts”, knowing such so called facts shape everything else, we should be more careful. Eventually those so called facts may be challenged in the light of new discoveries, new form of reasoning or simply a change in values.
I confess that for lack of time I have only read your reply and not all the others you ( or me) have generated. May be later.
Still, it is lovely to chat about what we believe, or disbelieve.
Cogito ergo sum.
T. aquaticus is the short name for the bacterial species Thermos aquaticus that is known for living in near boiling hot springs. This species is near and dear to the hearts of molecular biologists because we regularly use modified versions of its DNA polymerase to make copies of DNA in the polymerase chain reaction (PCR). Its polymerase is able to withstand prolonged exposure to near boiling temperatures which makes it useful for many reactions in molecular biology.
In science, we present data (i.e. facts) and try to convince other scientists with that data. We don’t give empty assertions and seek acolytes.
Could you give an example of a scientific consensus producing a false fact? Mind you, I’m not asking for a false or faulty conclusion, but a false fact.
So there is no such thing as facts?
In science, we don’t rely on people self reporting their opinion of colors. We measure the light and the intensity of light at different wavelengths. This is called spectroscopy. For example, different elements have different absorption and emission spectra:
By objectively measuring the light spectrum from each element we can have a set of shared objective data to work from, and we can then determine what elements are out in the universe, or in samples we take from here on Earth. In fact, we can use this same technique to measure light in wavelengths we can’ even see.
Do you think it is a bad thing to change our minds based on new facts?
6 Likes
It’s always good to see examples such as this. When people talk about science as if it were just a matter of opinion or interpretation or subjective worldviews, it always seems to me that they have no idea whatsoever about what scientists actually do or what constraints they operate under when analysing the data and drawing conclusions. Sometimes it seems that even after you explain it to them, they still don’t get it.
3 Likes
In a scientific paper you have sections titled Introduction, Methods (and Materials), Results, and Discussion. It could be viewed as a distillation of the scientific method itself where you come up with an idea based on existing research (Introduction), design experiments meant to test a hypothesis, wrangle the results of the experiments into statistical comparisons and summaries, and then describe the conclusions you come to based on the data (i.e. Discussion). Given your background in physics I am quite confident you would be able to differentiate between data and conclusions within the field you are most familiar with.
At the same time, there is the theory that backs measurements, but I don’t think that is what we are discussing here. For example, the inner workings of an electronic balance is based on a lot of theory and calibration, but when we weigh something on those balances we take their readings as facts without delving into all of the theory. In the field of cosmology the line does start to blur a bit. I have always thought of myself as a decently knowledgeable armchair cosmologist, but I was surprised to discover a new type of standard candle, the tip of the red giant branch (TRGB).
According to theory, red giants can only reach a specific luminosity, so measuring the peak red giant luminosity can be used as a standard candle like type Ia supernovae and Cepheid variables. Pretty cool.
I would describe conclusions as being more subjective. They are the best explanation that the author can come up with. Other scientists are free to take that same data and propose their own conclusion, hopefully with additional data from unique experiments that further tests the idea.
I have often noticed this about creationists in general. They often rely on arguments based on “because so-and-so says so”. What they miss is that scientists consider “because I say so” a non-starter. It’s the data that matters.
I often wonder what non-scientists think scientists discuss at conferences. Do they really think that a scientific presentation is solely composed of a scientist standing in front of a room and pronouncing their beliefs?
I would also include conclusions as part of human knowledge. We can arrive at knowledge both through observing and through evidence based reason. Faith based knowledge gets a bit too philosophical for me, but as long as the categories are well defined I have no problem with it.
3 Likes
Yes! This is exactly why empiricism (quantification) is crucial to science. One does not just rely on analysis of a personal, subjective description like “red” but on a wavelength that can be measured.
2 Likes
That has been my experience as well. I think it has to do with projection, something we all experience as humans. Creationists choose to believe in creationism for theological reasons and not because of evidence, so they assume evolutionists do the same. What most creationists don’t understand is the massive amount of facts that scientists are actually looking at and trying to explain. For example, it is extremely rare to find a creationist who has even heard of the nested hierarchy, much less able to explain what it is and how to apply it.
To keep with the theme of the thread, I don’t necessarily expect creationists to know enough about biology to address the accuracy of the theory of evolution because high school biology is pretty basic. At the same time, humility should kick in at some point. What are the chances someone with a basic, high school level of knowledge in biology is going to see a problem with a theory within biology that isn’t visible to millions of highly trained biologists over the last 100 years?
My general advice for the creationists out there is to ask more questions. If you go to a creationist website and think you have found the silver bullet to kill of evolution, just realize you probably haven’t found the silver bullet. It’s akin to someone watching a flat earth youtube video and thinking they have discovered THE EVIDENCE that is going to take down the globe earthers.
7 Likes
That advice will go on deaf ears.
I will not profess to know the full ins and outs of the nested hierarchy, but I do know physiology. (That has not changed in the last years or so) I also know what genetics and genomes are. I know enough to understand what you think you can see and why. I am not interested in some numbers game you bac it up with.
It is not about Scripture. it is about the the theory you are trying to bolster. It still don’t work no matter what connections you think you can see. If you can’t join the dots there is no point in laying them out. The process is just not up to the task. Perceived connections do not prove anything if you cannot get the progression between them. And it would appear that no one is actually trying to do so. The basic process of evolution has not changed in 50 years either. All your data is corroborative it is not proof.
Reading or questions won’t change that.
Richard
If you aren’t interested in the “numbers game” then you aren’t interested in the facts.
We have connected the dots, but you refuse to accept the facts that join those dots, such as the pattern of transition and transversion mutations that connect the dots.
False. You refuse to acknowledge the existence of the progression between them, such as the transitional fossils between non-avian dinosaurs and birds.
All scientific theories need is corroborative evidence. Scientists are smart enough to know that absolute proof is outside the reach of humans.
2 Likes
IOW we can’t prove it but it’ll do.
From what i have seen they are three dimensional versions of two dimensional fossils and a lot of visual similarities.
That progression is one of the least plausible ones.and yet seems to be a clincher.
Still, I guess its better than ossifying a gill slit to make a jaw bone.
Richard
That applies to all scientific theories, including the ones you readily accept.
2 Likes
Hi Aquaticus, yes, should have thought you will bring the spectroscope up.
Sure you can measure wavelength. I can use a tape measure to tell you this length of timber is one meter long. That is not my point.
Everything you see, including your light measuring machine or my measuring tape, is a creation inside your brain and mine.
Nothing you see is an accurate depiction of the reality in front of us. What we see is a creation inside our brain and may not bear any resemblance of the world in which we live. It is in fact a reflection of what we expect to see based on an array of beliefs, values and anti values we hold.
That is why I say all is relative and subjective.
As for your question “Do you think it is a bad thing to change our minds based on new facts?” … what is a bad thing? I think it is not right to judge others based on our own personal perception of reality. The OP was about demanding from others to be of some particular academic level to qualify in a discussion.
Considering that so called facts today turn into tomorrow’s academic joke, (examples abound), the above demand is rather silly.
What you consider a fact today can turn into a falsehood as soon as new evidence comes to light. And facts are rubbery anyway due to our own relativity.
We should all use a signature in our post like some form of disclaimer.
I suggest Plato (or Socrates, who knows):
Scio me nihil scire.
Hooroo. 
PS
Considering what I just wrote, clearly it makes more sense to live by faith than by facts.
Consider walking … each time you take a step, you hope your foot will meet solid ground, based on an array of assumptions and faith in your previous experience. We live by faith, we walk by faith. Facts?
And yet you will look both ways before crossing the street. Why?
If you are like most people, when you get an infection you will probably go see a doctor who will use the most recent scientific evidence to prescribe you an antibiotic. Why do you do this?
In the sciences, people are judged by that very thing.
Perhaps you could give us an example to work from.
How could anything be shown to be a falsehood given the worldview you espouse?
I would contend that you live by facts instead of faith. That’s why you look both ways before crossing the street, and go see a doctor to get the most recent science based treatments.
3 Likes
27 posts were split to a new topic: Dietary Debates