Even just having extra quantities of the same DNA can cause enormous differences. Edward’s syndrome (extra copy of chromosome 18) means most do not survive long enough to be born and few live past 1 year of age. Patau syndrome is much the same story with chromosome 13 although in that case sometimes only portions of the chromosome are duplicated and the child lives a bit longer. And of course there is Down’s syndrome (extra chromosome 21) which is better known. This duplication can happen with any chromosome. These are just those which happen more often and survive longer. Many are miscarried so quickly that they are not aware of being pregnant.
Of course… I am not a biologist (like glipsnort… so I certainly wasn’t trying to inform him of these things). I just love looking these things up. Just today I was telling family members about another thing I investigated. So many cuisines around the world use red pepper I wondered what people did before the discovery of America which is where all such peppers come from. Well not quite all pepper. There is black pepper (which came from India) and it turns out there were variants of black pepper used around the world before these American peppers were discovered, such as long pepper, as well as an unrelated Sichuan pepper used in China with quite a different culinary effect. Otherwise we just had such things as mustard, ginger and cinnamon to add spice to the experience of life.
Absolutely. Even having the same DNA but arranged differently can have major consequences, e.g. the ‘Philadelphia chromosome’, in which bits of chromosomes 9 and 22 exchange places, and which causes leukemia.
Expanding on my answer, since I’m not sure I answered the right question. When we say that DNA is shared, exactly what we mean depends on the context. ‘Shared’ means that the two copies share a recent common ancestor, and what counts as recent varies with the application. If you’re talking about your extended family, it means within the last few generations. If you’re talking about modern humans sharing DNA with Neanderthals, it means within the last 100,000 years. And with chimpanzees and humans, it means within the last ~10 million years.
Since I’m not sure if you did or not, it’s clear to me that my question needs considerable improvement. Unfortunately for me, I’m worried that I lack the knowledge to improve it.
Initially, you said:
I readily agree because, as ignorant as I am, I know–as an avid, amateur, genetic genealogist myself–I don’t know what “sharing”, in the context of the statement which I quoted: i.e. " “Humans and chimps share a surprising 98.8 percent of their DNA”, means. In that context, my question is: “What’s being shared by humans and chimps?”
Frankly, humans and chimps sharing more than 0% of their DNA surprises me, and a claim that humans and chimps share 98.8 percent of their DNA is no less mysterious than a claim that humans and chimps share >0% of their DNA. But I didn’t make up the claim, someone else did; and the claim has enough fans, that it appears, IMO, to be a very common claim.
I’m not saying that the claim is false; I’m saying that I don’t understand the claim. My problem is that I’m afraid that the information I need in order to refine and improve my question may require more patience and work to enlighten me than anybody around here or anywhere, for that matter, is willing to put into the effort of shedding enough light on the subject to make it make sense to me.
Consequently, I’m currently trying to come up with a strategy, or a list of question, the answers to which I hope will lead me to a better understanding of the various ways in which living things “share DNA.”
At the most basic level, shared DNA is DNA that is very similar, too similar to be the result of chance. You can think of DNA as a molecule that’s made up of a long string of 4 different ‘bases’ (A,C,G,T) that can occur in any order. If two copies of the genome – yours and mine, or mine and chimp’s – have a stretch of bases that are nearly identical, then that’s a segment of shared DNA. For example, the top row here shows a stretch of the bases in human DNA. The bottom row shows a stretch of bases in chimpanzee DNA (in this case, a stretch covering bases 27,014,181 through 27,014,238 on chimpanzee chromosome 8). This is the only stretch in chimp DNA that looks anything like that stretch of human DNA, and it’s 100% identical.
The conventional explanation for this kind of similarity between DNA copies – which goes on for millions of bases – is that the two copies descend from an ancestor that they have in common. That is, the copies are similar because they’re literally copies of the same thing.
A practical fairly familiar example of simularity is found in the genes that make insulin, which is a polypeptide (sort of a short protein). Insulin made by pigs and cows is not identical, but is similar enough to human insulin to work at lowering blood sugar, and was the prominent commercial form that kept diabetics alive until genetic engineering produced bacteria that produces human insulin in the 1980s.
Chimp insulin and human is identical in amino acid sequence reflecting the closer relation, although the base pair sequence of the DNA has some differences, according to some of articles I googled (multiple codes can give the same amino acids if some readers are not familiar with that) Other monkeys and new world monkeys show further divergence as one would expect.
In any case, it is interesting to see how these relationships play out in everyday life.
Here are two made up sequences that I hope will illustrate the types of similarities scientists are describing.
tcagtcccgtatcgattagaggtggtcggttatgtgaactccgctcttataggaccattg
___+_________^^^________________________+___________________
tcattcccgtatc---tagaggtggtcggttatgtgaactacgctcttataggaccattg
60 bases total
There are three regions where the sequences differ. There are two places where the bases are different, and a 3 base region where there are bases that were either inserted into one sequence or deleted in the other. The switched bases we call substitution mutations. The 3 base region we call an indel because we can’t know if it is an insertion or a deletion.
So how do we describe the differences and similarities between these sequences? Scientists have different questions they want to ask, so there are different answers to those questions. First, out of the DNA that they share through common ancestry how many bases are still the same? That would be 58 out 60 bases, or 96.7% similar. How many mutations are there? There are 3 mutations, but this is usually described as a mutation rate and not as a percentage. Overall, how similar are the two sequences? There are the 2 substitution mutations and the 3 base indel, so the sequences differ overall by 5 bases, or 55/60 = 91.7% similar.
One of the reasons scientists are interested in the number of substitution mutations (the two bases that are different) is that these mutations occur at a more clock-like rate compared to indels. This allows for some rough calculations for divergence times, and they are also a bit easier to model if my understanding of the field is correct.
Is it correct to say that the sequences differ by 96.7 and 91.7%? Yes. The important part is to be clear about the type of comparison one is doing.
A Beginner’s guide to important distinctions in the act of sharing.
Siamese twins share the same DNA in a way that no two or more other people do.
Physically separate, identical twins share the same DNA in a way that Siamese twins can’t.
Fraternal twins share the same DNA to a lesser degree than Siamese and Identical twins do.
It is not uncommon for fraternal twins to share the same DNA, but never to the same extent as identical twins and frequently not to the same extent, even, as other fraternal twins do.
Sharing food before it is eaten is a virtue; not so much, however, after it is eaten.
Humans share the same genome [Pronunciation: “Gee-nohm”].
“The genome is often described as the information repository of an organism. Whether millions or billions of letters of DNA, its transmission across generations confers the principal medium for inheritance of organismal traits. Several emerging areas of research demonstrate that this definition is an oversimplification. Here, we explore ways in which a deeper understanding of genomic diversity and cell physiology is challenging the concepts of physical permanence attached to the genome as well as its role as the sole information source for an organism.”
“The term genome was coined in 1920 to describe “the haploid chromosome set, which, together with the pertinent protoplasm, specifies the material foundations of the species”. The term did not catch on immediately. Though Mendelian genetics was rediscovered in 1900, and chromosomes were identified as the carriers of genetic information in 1902, it was not known in 1920 whether the genetic information was carried by the DNA or protein component of the chromosomes . Furthermore, the mechanism by which the cell copies information into new cells and converts that information into functions was unknown for several decades after the term “genome” was coined.”
“Today, however, we are awash in genomic data. A recent release of the GenBank database, version 210.0 (released on October 15, 2015), contains over 621 billion base pairs from 2,557 eukaryal genomes, 432 archaeal genomes, and 7,474 bacterial genomes, as well as tens of thousands of viral genomes, organellar genomes, and plasmid sequences. We also now have much broader and more detailed understandings of how the genome is expressed and how different biological and environmental factors contribute to that process. Even so, almost a century after coining the term, the standard definition of the genome remains very similar to its 1920 predecessor. For example, on its Genetics Home Reference website, the National Institutes of Health (NIH) definition reads: “An organism’s complete set of DNA, including all of the genes, makes up the genome. Each genome contains all of the information needed to build and maintain that organism” (MedlinePlus: Genetics, on February 1, 2016).”
“With a greater understanding of genomic content, diversity, and expression, we can now reassess our basic understanding of the genome and its role in the cell. For example, closer scrutiny of the NIH definition reveals that its two halves are mutually exclusive; that is, the “complete set of DNA” cannot be “all of the information needed to build and maintain (an) organism.” Of course, this was probably meant to be a simplified definition for both scientists and nonscientists. While it is useful to continue thinking of the genome as a physical entity encoding the information required to maintain and replicate an organism, our present understanding shows that this definition is incomplete.”
“In 2003, with less glitz but still plentyof headlines, the human genome was declared complete once again.”
“But actually, the human genome was still not complete. Even the revised draft was missing about 8 percent of the genome. These were the hardest-to-sequence regions, full of repeating letters that were simply impossible to read with the technology at the time.”
" Finally, this May, a separate group of scientists quietly posted a preprint online describing what can be deemed the first truly complete human genome—a readout of all 3.055 billion letters across 23 human chromosomes."
The amount of shared DNA is the same for identical and conjoined twins.
Fraternal twins share the same amount of DNA (on average) as siblings who are born at different times.
All humans have a unique genome (except for identical twins, sort of) that is not found in any living human being nor in any dead or future human being. Since each human is born with about 50 substitution mutations and perhaps a indel or recombination event here and there it is guaranteed that their genome is unique in all of time.
If you mean the reference human genome . . . yes, it is incomplete. There are a handful of regions that are difficult to sequence, but they comprise a small part of the genome. Newer technology does hold the promise of getting a complete sequence:
Perhaps it is more accurate to say identical twins share the same alleles? That is a question as I am fuzzy on the terminology. Since we have multiple alleles in a population, that accounts for the difference between you and me, but how are different alleles counted when looking at the difference between a chimp and me?
Since an allele is a specific version of DNA, I have no problem with calling shared alleles shared DNA.
They aren’t. Alleles are alternative versions that appear variously in different individuals – the idea is that they can be swapped in for one another. Differences between species aren’t generally considered alleles.
The chimp genome was sequenced in 2005. Not finished, to be sure, but a heck of a lot of it was sequenced, more than enough to give a very good idea of what the differences are between the human and chimp genomes.
And before that, you could mix DNA samples from humans and chimps and see how much of it stuck together. That approach is not sensitive to the variations in copy number. That was the earliest source of a percent difference value. The variations in calculation over time have been misrepresented as an excuse to dismiss the numbers (and those calculating them) in some anti-evolutionary circles.
The “amount of shared DNA” proportions cited for siblings, etc. is often confusing because it ignores the fact that all members of a species have most of the DNA matching. In that context, they are talking about how much of the DNA has the exact same ancestry, ignoring the fact that DNA with slightly different ancestry is mostly the same.
Many bivalves have biparental inheritance of mitochondria, as a complication to the system.
Identical twins are essentially clones. They are genetically identical . . . sort of. There are still somatic mutations early in embryonic development which can produce small differences between twins, perhaps 5 or so mutations if I had to speculate. To put it a different way, identical twins share as much DNA as the cells in your own body share with each other.
Thanks. I know a couple of kids who are twins, and tell them apart by a couple of moles but primarily because the hair swirl on one’s head is clockwise, the other counterclockwise. Sort of cis and trans.
Where it gets confusing for me is the terminology where DNA match is compared, and how it is defined differently between you and me (due to different alleles) and me and monkey. But this has helped with that.
They will have different fingerprints as well. They may start off as two balls of cells with the same DNA, but there is a bit of chaos in the process which can produce different results during embryonic development.
Alleles are different versions of the same gene in the same species. Even this terminology can be confusing at times because it can be defined by either phenotype or DNA sequence. The terminology can also be applied to non-genes.
If we are comparing DNA between species then we use terms like homolog, ortholog, and paralog:
In all cases, we align the sequences and count the places where they differ. Part of that process is determining which chunks of each genome should be aligned to one another, and there are standards and practices that govern those decisions. An alignment between multiple species might look like this:
