What does it mean to "share DNA"?

Terry_Sampson · July 25, 2021, 12:34pm

Fact: There are four different kinds of human DNA: autosomal DNA, X-DNA, Y-DNA, and mitochondrial DNA. The first three are located in the nucleus of a cell; the fourth is located in organelles that are also in a cell, but outside of the nucleus.
- Both biological parents pass on autosomal DNA.
- Biological mothers contribute X-DNA to their sons and daughters.
- Biological fathers contribute Y-DNA to their sons and X-DNA to their daughters.
- Biological mothers contribute mitochondrial DNA to sons and to daughters. Biological fathers do not contribute any mitochondrial DNA to sons or to daughters.
Twins can be monozygotic or dizygotic.
- Dizygotic (fraternal) twins may or may not be of the same sex.
- Monozygotic (identical) twins are of the same sex because they form from a single zygote (fertilized egg) that contains either male (XY) or female (XX) sex chromosomes.
  - Exception: Although extremely rare, a monozygotic twin may lose a Y chromosome and develop as a female. Fewer than 10 cases have been confirmed [Source: Can Boy/Girl Twins Be Identical? .
Monozygotic twins share the most DNA.
Dizygotic twins of the same biological parents share less DNA than monozygotic twins.
Dizygotic twins of different biological parents (i.e. half-siblings) share less DNA than dizygotic twins of the same biological parents.
Two eggs donated by different women but fertilized by the same donor sperm will–like half-siblings–share less DNA than dizygotic twins of the same biological parents.
Two eggs donated by different women and fertilized by different donor sperm will share the least DNA, if any.
So, when someone says: “Humans and chimps share a surprising 98.8 percent of their DNA” [Source: DNA: Comparing Humans and Chimps], what is shared?

jpm · July 25, 2021, 1:31pm

A good question, and look forward to learning a better understanding from our resident experts. I have the understanding that what you describe with twins siblings etc. is a sharing of alleles, not the overall genome, which is common to to all humans.
Have to go to church, but will check back later.

Klax · July 25, 2021, 1:39pm

That we are 16% banana.

mitchellmckain · July 25, 2021, 3:28pm

98.8 percent of the information we carry in our DNA is the same. We share almost all the same protein making sequences and almost all of the information acquired in the evolutionary process. It does not mean the differences are not significant but it does mean that a great deal of our biology works in precisely the same way. But more importantly it means we carry around the irrefutable evidence of the commonality of our origins, for the similarities of our biological functionality is not sufficient to explain the all the similarities in our DNA.

A far smaller portion of our biological processes are the same as that of a banana. But yes there are still some things which are the same as a banana plant – we both have the eukaryotic cells which make multicellular organisms and a chemistry which uses ATP and sugars to store and distribute chemical energy. And likewise we share a far smaller portion of our evolutionary history with banana plants going back to a common ancestor billions of years in the past rather than millions.

Ralphie · July 25, 2021, 3:52pm

Most of the 3 billion DNA base pairs that make up one human genome we share in common with others.

Ralphie · July 25, 2021, 3:53pm

That’s not a banana, that’s my nose.

glipsnort · July 25, 2021, 4:00pm

I have to say, ‘share 98.8 percent of their DNA’ is not the best way of describing the situation. Here’s what we see when we compare the human and chimpanzee genomes:

1.5% is absent from the chimp genome, in small- and medium-sized pieces (with a similar amount of the chimp genome absent from the human genome). These differences represent either deletions from the chimp genome or insertions (usually of DNA duplicated from elsewhere in the genome) into the human genome.
Roughly 2.5% lies in large segments that are duplicated in the human genome but not in the chimp genome. All of the copies are similar to some segment of chimp.
Within the remaining ~96% of the genome – the part that is clearly shared – there are single-base differences at 1.2% of the bases.

Note: some of these numbers may have changed slightly with improvements to the human and chimp genome assemblies but the basic picture should be stable.

mitchellmckain · July 25, 2021, 5:37pm

Even just having extra quantities of the same DNA can cause enormous differences. Edward’s syndrome (extra copy of chromosome 18) means most do not survive long enough to be born and few live past 1 year of age. Patau syndrome is much the same story with chromosome 13 although in that case sometimes only portions of the chromosome are duplicated and the child lives a bit longer. And of course there is Down’s syndrome (extra chromosome 21) which is better known. This duplication can happen with any chromosome. These are just those which happen more often and survive longer. Many are miscarried so quickly that they are not aware of being pregnant.

Of course… I am not a biologist (like glipsnort… so I certainly wasn’t trying to inform him of these things). I just love looking these things up. Just today I was telling family members about another thing I investigated. So many cuisines around the world use red pepper I wondered what people did before the discovery of America which is where all such peppers come from. Well not quite all pepper. There is black pepper (which came from India) and it turns out there were variants of black pepper used around the world before these American peppers were discovered, such as long pepper, as well as an unrelated Sichuan pepper used in China with quite a different culinary effect. Otherwise we just had such things as mustard, ginger and cinnamon to add spice to the experience of life.

glipsnort · July 25, 2021, 5:48pm

Absolutely. Even having the same DNA but arranged differently can have major consequences, e.g. the ‘Philadelphia chromosome’, in which bits of chromosomes 9 and 22 exchange places, and which causes leukemia.

Ralphie · July 25, 2021, 6:52pm

Not always. My test proved I had 100 percent monkey DNA

glipsnort · July 25, 2021, 9:26pm

Expanding on my answer, since I’m not sure I answered the right question. When we say that DNA is shared, exactly what we mean depends on the context. ‘Shared’ means that the two copies share a recent common ancestor, and what counts as recent varies with the application. If you’re talking about your extended family, it means within the last few generations. If you’re talking about modern humans sharing DNA with Neanderthals, it means within the last 100,000 years. And with chimpanzees and humans, it means within the last ~10 million years.

Terry_Sampson · July 25, 2021, 11:13pm

Since I’m not sure if you did or not, it’s clear to me that my question needs considerable improvement. Unfortunately for me, I’m worried that I lack the knowledge to improve it.

Initially, you said:

I readily agree because, as ignorant as I am, I know–as an avid, amateur, genetic genealogist myself–I don’t know what “sharing”, in the context of the statement which I quoted: i.e. " “Humans and chimps share a surprising 98.8 percent of their DNA”, means. In that context, my question is: “What’s being shared by humans and chimps?”

Frankly, humans and chimps sharing more than 0% of their DNA surprises me, and a claim that humans and chimps share 98.8 percent of their DNA is no less mysterious than a claim that humans and chimps share >0% of their DNA. But I didn’t make up the claim, someone else did; and the claim has enough fans, that it appears, IMO, to be a very common claim.

I’m not saying that the claim is false; I’m saying that I don’t understand the claim. My problem is that I’m afraid that the information I need in order to refine and improve my question may require more patience and work to enlighten me than anybody around here or anywhere, for that matter, is willing to put into the effort of shedding enough light on the subject to make it make sense to me.

Consequently, I’m currently trying to come up with a strategy, or a list of question, the answers to which I hope will lead me to a better understanding of the various ways in which living things “share DNA.”

Bill_II · July 26, 2021, 12:19am

You might want to read through this thread

and also it’s parent thread. I understand they both share a lot of the same DNA.

glipsnort · July 26, 2021, 12:30am

At the most basic level, shared DNA is DNA that is very similar, too similar to be the result of chance. You can think of DNA as a molecule that’s made up of a long string of 4 different ‘bases’ (A,C,G,T) that can occur in any order. If two copies of the genome – yours and mine, or mine and chimp’s – have a stretch of bases that are nearly identical, then that’s a segment of shared DNA. For example, the top row here shows a stretch of the bases in human DNA. The bottom row shows a stretch of bases in chimpanzee DNA (in this case, a stretch covering bases 27,014,181 through 27,014,238 on chimpanzee chromosome 8). This is the only stretch in chimp DNA that looks anything like that stretch of human DNA, and it’s 100% identical.

The conventional explanation for this kind of similarity between DNA copies – which goes on for millions of bases – is that the two copies descend from an ancestor that they have in common. That is, the copies are similar because they’re literally copies of the same thing.

jpm · July 26, 2021, 2:11am

A practical fairly familiar example of simularity is found in the genes that make insulin, which is a polypeptide (sort of a short protein). Insulin made by pigs and cows is not identical, but is similar enough to human insulin to work at lowering blood sugar, and was the prominent commercial form that kept diabetics alive until genetic engineering produced bacteria that produces human insulin in the 1980s.
Chimp insulin and human is identical in amino acid sequence reflecting the closer relation, although the base pair sequence of the DNA has some differences, according to some of articles I googled (multiple codes can give the same amino acids if some readers are not familiar with that) Other monkeys and new world monkeys show further divergence as one would expect.
In any case, it is interesting to see how these relationships play out in everyday life.

T_aquaticus · July 26, 2021, 4:15pm

Here are two made up sequences that I hope will illustrate the types of similarities scientists are describing.


tcagtcccgtatcgattagaggtggtcggttatgtgaactccgctcttataggaccattg
___+_________^^^________________________+___________________
tcattcccgtatc---tagaggtggtcggttatgtgaactacgctcttataggaccattg

60 bases total

There are three regions where the sequences differ. There are two places where the bases are different, and a 3 base region where there are bases that were either inserted into one sequence or deleted in the other. The switched bases we call substitution mutations. The 3 base region we call an indel because we can’t know if it is an insertion or a deletion.

So how do we describe the differences and similarities between these sequences? Scientists have different questions they want to ask, so there are different answers to those questions. First, out of the DNA that they share through common ancestry how many bases are still the same? That would be 58 out 60 bases, or 96.7% similar. How many mutations are there? There are 3 mutations, but this is usually described as a mutation rate and not as a percentage. Overall, how similar are the two sequences? There are the 2 substitution mutations and the 3 base indel, so the sequences differ overall by 5 bases, or 55/60 = 91.7% similar.

One of the reasons scientists are interested in the number of substitution mutations (the two bases that are different) is that these mutations occur at a more clock-like rate compared to indels. This allows for some rough calculations for divergence times, and they are also a bit easier to model if my understanding of the field is correct.

Is it correct to say that the sequences differ by 96.7 and 91.7%? Yes. The important part is to be clear about the type of comparison one is doing.

Terry_Sampson · July 26, 2021, 6:32pm

A Beginner’s guide to important distinctions in the act of sharing.
1. Siamese twins share the same DNA in a way that no two or more other people do.
2. Physically separate, identical twins share the same DNA in a way that Siamese twins can’t.
3. Fraternal twins share the same DNA to a lesser degree than Siamese and Identical twins do.
4. It is not uncommon for fraternal twins to share the same DNA, but never to the same extent as identical twins and frequently not to the same extent, even, as other fraternal twins do.
5. Sharing food before it is eaten is a virtue; not so much, however, after it is eaten.
6. Humans share the same genome [Pronunciation: “Gee-nohm”].
  - What Is a Genome?
    - “The genome is often described as the information repository of an organism. Whether millions or billions of letters of DNA, its transmission across generations confers the principal medium for inheritance of organismal traits. Several emerging areas of research demonstrate that this definition is an oversimplification. Here, we explore ways in which a deeper understanding of genomic diversity and cell physiology is challenging the concepts of physical permanence attached to the genome as well as its role as the sole information source for an organism.”
    - “The term genome was coined in 1920 to describe “the haploid chromosome set, which, together with the pertinent protoplasm, specifies the material foundations of the species”. The term did not catch on immediately. Though Mendelian genetics was rediscovered in 1900, and chromosomes were identified as the carriers of genetic information in 1902, it was not known in 1920 whether the genetic information was carried by the DNA or protein component of the chromosomes . Furthermore, the mechanism by which the cell copies information into new cells and converts that information into functions was unknown for several decades after the term “genome” was coined.”
    - “Today, however, we are awash in genomic data. A recent release of the GenBank database, version 210.0 (released on October 15, 2015), contains over 621 billion base pairs from 2,557 eukaryal genomes, 432 archaeal genomes, and 7,474 bacterial genomes, as well as tens of thousands of viral genomes, organellar genomes, and plasmid sequences. We also now have much broader and more detailed understandings of how the genome is expressed and how different biological and environmental factors contribute to that process. Even so, almost a century after coining the term, the standard definition of the genome remains very similar to its 1920 predecessor. For example, on its Genetics Home Reference website, the National Institutes of Health (NIH) definition reads: “An organism’s complete set of DNA, including all of the genes, makes up the genome. Each genome contains all of the information needed to build and maintain that organism” (MedlinePlus: Genetics, on February 1, 2016).”
    - “With a greater understanding of genomic content, diversity, and expression, we can now reassess our basic understanding of the genome and its role in the cell. For example, closer scrutiny of the NIH definition reveals that its two halves are mutually exclusive; that is, the “complete set of DNA” cannot be “all of the information needed to build and maintain (an) organism.” Of course, this was probably meant to be a simplified definition for both scientists and nonscientists. While it is useful to continue thinking of the genome as a physical entity encoding the information required to maintain and replicate an organism, our present understanding shows that this definition is incomplete.”
    - Say what??? Incomplete?

Terry_Sampson · July 26, 2021, 6:44pm

The Human Genome Is—Finally!—Complete. The Atlantic, by Sarah Shang, June 11, 2021.

“In 2003, with less glitz but still plenty of headlines, the human genome was declared complete once again.”
“But actually, the human genome was still not complete. Even the revised draft was missing about 8 percent of the genome. These were the hardest-to-sequence regions, full of repeating letters that were simply impossible to read with the technology at the time.”
" Finally, this May, a separate group of scientists quietly posted a preprint online describing what can be deemed the first truly complete human genome—a readout of all 3.055 billion letters across 23 human chromosomes."

T_aquaticus · July 26, 2021, 9:25pm

The amount of shared DNA is the same for identical and conjoined twins.

Fraternal twins share the same amount of DNA (on average) as siblings who are born at different times.

All humans have a unique genome (except for identical twins, sort of) that is not found in any living human being nor in any dead or future human being. Since each human is born with about 50 substitution mutations and perhaps a indel or recombination event here and there it is guaranteed that their genome is unique in all of time.

If you mean the reference human genome . . . yes, it is incomplete. There are a handful of regions that are difficult to sequence, but they comprise a small part of the genome. Newer technology does hold the promise of getting a complete sequence:

https://www.nature.com/articles/s41586-020-2547-7

Added in edit:

They are actually a lot closer to a complete genome than I thought. This is from just last June:

Pre-print here:

I also see that you have a link to what appears to be the same study. Kudos.

Terry_Sampson · July 26, 2021, 10:09pm

Of course it is. But as I stated, the physically separate, identical twins share the same DNA “in a way that conjoined twins don’t.”

Can Identical Twins Be Different Sexes?

Too bad that I didn’t end my posts with

You’d have told me something I didn’t know.

I mean what the source that I quoted means.