I am showing you evidenced based scientific conclusions. If you understood what a nested hierarchy is then you wouldn’t claim that reusing biological building blocks would necessarily produce a nested hierarchy. It’s that simple.
1 Like
Like I said. You are just trotting out your dogmas and trying to" teach" me.
I know what you think and i knw why you think it.(You have repaeted it so often) That does not mean I have to agree with it.
The fact is, you have no idea what Creation would look like if God was at the helm and cannot prove one way or the other that He isn’t. And there is no need to repeat the “invisible hand of God” routine either.
Richard
In what way are they dogmas?
Then show me how I am wrong. Why would this necessarily result in a nested hierarchy?
“If God created, He would use the same building bricks which would produce the look of caommon ancestry.”
I do know what Creation would look like if species share a common ancestor and evolved through the mechanisms described by the theory of evolution. We would see a nested hierarchy, and that is exactly what we see.
What you are now stumbling across is the law of parsimony. Your argument was already addressed 140 years ago.
2 Likes
You won;t listen.
You have a view. I have a view.They do not match, but you claim higher ground because it is “sceience”. That has been the whole point of my input to this thread. That arogant higher view.
IOW you cannot even consider my view because it does not match yur "scienctific " one.
How can you be sure that it wouldn’t? You have no frame of referance.
except that yu do not have the mechannisms to connect the dots that you have identified. The thrust of study has left the mechanisms and concentrated on DNA mapping. . You know as well as I do that the map is not enough. You have no idea how the sequences actually produce bones or hearts or anything else. Or how they are "“designed” to fit perfectly. (By fluke!)
IOW you still cannot trace the way the development occurs even if you thiink you have the road. You still need to be able to travel that road and get from sngle cell to Human
You can quote any scientist you like, it is no better than me quoting Scripture.
RIchard
I am listening. I will repeat.
Then show me how I am wrong. Why would this necessarily result in a nested hierarchy?
“If God created, He would use the same building bricks which would produce the look of caommon ancestry.”
You are the one putting science on higher ground. If this wasn’t the case then you would have no problem agreeing that the ToE is scientific. Instead, you try your darndest to convince people the ToE is not science as a way of discrediting it.
I do. I have even linked you to the evidence. Here it is again.
What exactly are you arguing against now? Are you trying to say our DNA has nothing to do with how we develop in the womb or afterwards? Are we each supernaturally created?
3 Likes
It is not historical evidence for the resurrection… Of that, there can be none. What you can say is if the Christian belief in this miracle is true, there are some things that we should be able to reconstruct historically. Such as that Jesus existed, he was crucified, he called disciples, he was perceived as a miracle worker, many of his earliest followers thought he rose from the dead very shortly after his death…but you will never get to the Resurrection on historical grounds.
You might even want to call it circumstantial evidence for the resurrection. But even then other alternatives are readily available. Maybe necromancers stole the body of a holy man they thought had special powers to use it for their own benefit. At the end of the day we cannot know what happened via the tools of pure academic history if a miracle did occur because they assume naturalism. As a general principle we try to reconstruct what most likely happened based on what behaviors and actions are most plausible to us. But surely the consistency of nature is greater than that of human behavior.
We can say there is nothing historically that says Jesus was not resurrected and many details that such a belief depends on can be shown to be true or historical. Nothing more can be said beyond that on historical grounds. Based on the historical evidence we can assess, one can conclude that belief in the resurrection via faith is at least plausible but it by no means demonstrable.
2 Likes
No.
And really I am at a loss here. I can’t seem to get you to understand the “concepts” involved , either in comstruction or developmet. And you get all defensive over DNA.
No. But you do not know how it does it. How it gets from a DNA sequence to a femur or a heart. How does that sequence build specific componants, i
- the right size and shape
- in the right place
- complete with all ancilliary muscles, tendons, skin or whatever/
I hav e never claimed that. It is always accepted that the basic mechanism is in place,rather than completely “Hands on”
But
ToE relies and “random” deviations. All God has to do is put in some sort of parameter or bias and what looks like “random” becomes “created”. And there is no way n earth you or I could tell the difference.The ancestry is the same. The DNA is the same. But the mechanism is not ToE.
So what was wrong with my answer?
Again no.
I acknowledge that ToE is the scientific view. But you do not seem to acknowledge that there can be any other view. Hence the superiority.
Even if you give lipserveice to possibilites of error or incompleteness, you do not take them seriously. You need “proof”. Sorry it does not exist!
Richard
You aren’t presenting any concepts.
Why are humans and chimps different from each other? Is it due to the sequence differences between our genomes?
If yes, then the mechanisms of common ancestry, mutation, and natural selection are obviously applicable. What I have shown you over and over is the evidence for mutations being the cause for the differences between the human and chimp genome, as well as the differences between humans and other vertebrates.
Why would this result in an excess of transition and CpG mutations?
Would you agree that the same process of mutation we see happening in real time is the same process that produced the differences between species through history?
You haven’t answered.
Then show me how I am wrong. Why would this necessarily result in a nested hierarchy?
“If God created, He would use the same building bricks which would produce the look of caommon ancestry.”
Obviously, non-scientific views exist. What I am asking for is the reasoning behind them. For example, we would expect to see a nested hierarchy with all of the natural mechanisms described in the ToE. Do you agree or not?
Would you apply the same logic to forensic science? Would you reject fingerprint evidence because God could have planted them at the crime scene without the defendant ever being present? How would you know, right?
2 Likes
No, that is just your anser and logic, it does not necesarily follow.
You do not know how thw differences occur because yu do not know the mechanisms involved. You are just…
guessing?
deducing?
whatever it is it is still subjective himan rasoning, based on the theory you have in place.
You have shown differences. Uou assume tht they are muttions. Have you ever watched a mutation happen?
Why shuls a mutation happen?
Is it a flaw in DNA or an attribute of DNA?
prove it!
You can’t.
So you?
Extrapolate?, sumise? assume?
You cannot see the way a primal aimal evolves. You cannot watch it. There is no data available, it is lost in the annals of time.
so you?
(Do need to repeat it?)
The whole thing is a concept, in fact more than one concept combied. The concept of mutating DNA. The conceot of ancestry. The concept of evoltion, the concept of development Yhe concept of complexity?
Science has conceptualisation both interms of its methodology and the way data is understood. That is what sciece is,
Yes I did. The answer was, How can you tell? (Whether God is there or not) There is no data. That is the nswer. Unsatisfactory or not, it is the only plausible one from where I stand. And you cannot give an answer to it. (And that is also conceptual)
The problem here is that concepts are seen as somehow unscientific., yet they are the heart of every theory or law in existence.
Richaqrd
This strikes me as something like the “watchmaker” fallacy. That is, the assumption that because entities share one attribute, they must share all attributes.
If you aren’t familiar with it, we can state it in this context:
- a watch exhibits complexity and the parts fit together perfectly. A watch has a designer.
- Biological organisms exhibit complexity and the parts fit together perfectly. Therefore biological organisms have a designer.
The fallacy is in the assumption that because entities share one attribute, they must share all attributes. The following illustration was given by Dr. Collins in his book The Language of God.
-
Electrical current consists of a flow of electrons. Electrical current in my home comes from the power company.
-
Lightning consists of a flow of electrons. Therefore lightning comes from the power company.
Watchmaker arguments are not scientific arguments.
I see God’s Hand in the existence of order in Creation, rather than trying to explain the mechanisms, such as biological evolution, as needing divine intervention. But that is a philosophical argument, not a scientific one.
2 Likes
We do know the mechanisms that cause mutations, and substitution mutations in particular.
First, the enzyme responsible for replicating DNA can incorporate the non-complementary base because the fit between the enzyme’s active site and nucleotides is loose. This process favors mutations of similar bases which are called transitions.
You will notice that two fo the bases have a single ring and two have two rings. These are the purines and pyrimidines. An adenine is more likely to be mutated to a guanine than to either a cytosine or thymine. This causes the excess of transition mutations.
The second major mechanism is deamination of methylated cytosines. DNA methylases will often attach a methyl group to a cytosine when it is just upstream of a guanine, a two base sequence called a CpG (cytosine-phosphate-guanine). If the methyl group is is removed by deamination then it becomes a thymine. This thymine is copied as the complementary adenine when the modified DNA is replicated.
While CpG’s are not as abundant as any given single base, CpG mutations still make up a disproportionate number of substitution mutations. In the case of the comparison of the human and chimp genomes, about a 3rd of all substitution mutations (if memory serves).
So yes, we understand the mechanisms.
It is observation and chemistry. There’s nothing subjective about it.
I am making no such assumption. We can observe the spectrum of mutations as they occur in real time. For humans, it looks like this.
As you can see, there is a large excess in transition mutations, as we would expect from known mechanisms. Now lets compare primate genomes and look at the differences between them.
We see that exact same pattern that we would expect from the known mechanisms that produce mutations. This is the evidence that leads to the supported conclusion that the differences between primate genomes, including humans, are due to the known and observed mechanisms that produce mutations.
Genomes are a direct record of a species evolution.
When the results are consistent with a natural process we don’t invent a supernatural process that exactly mimics the results of a natural process.
3 Likes
No, that is not what I was driving at.
The point is that sicence has idetified DNA as the method of construction, but not how it works. DNA splits and marries to a ribozone and produces amino acids, but how that turn into a bone or a heart or even a hydra is anyone guess. It is not yet known. Therefore any theory that relies on DMA matching is done so without understanding what they are comparing. It could be the same as a menu for a madeira cake or a blueprint for a sky scraper, but any analogy fails because we simply do not know.
I am not claiming any sort of design, here. Although it would be fair to say that the DNA working is central to creation and if it is a code it would be virtually impossible for it to occur by accident. it is, like electrons or neutrons, so basic it defies creation let alone random or acidental creation
I would also suggest that both water and carbon have a similar uniqueness that is required for living things on this earth. Accidental? well I guess people do win the loottery.
Richard.
It’s not subjective, it’s the result of observation: nowhere have anything but simple changes been observed.
Good article even reading it the third time.
What it comes down to for me is that since all the evidence points to common descent via natural selection, and since Richard insists that that’s just the way that God did it, then QED Richard’s God is Loki the Trickster
1 Like
I view it more as a question of adequacy.
For example, if I claimed I had the supernatural ability to predict the flip of a coin, how would we go about testing this? The classic way is to observe how often I correctly predict the flip of a coin. If after 1,000 tests I correctly guess 50% of them, have I demonstrated the supernatural ability to predict coin flips? I would say no. Random guessing would have been adequate for getting 50% of the predictions right.
The same applies to mutations. The amount of divergence seen between the genomes of species can be produced by the mutation rate we observe in these species. On top of that, the spectrum of mutations is consistent with the known mechanisms that produce random mutations, so they look exactly like mutations. This known process is more than adequate for producing these changes.
At the same time, I fully recognize the theistic belief that God and nature are tied together in some manner. However, most evolutionary creationists I talk to don’t expect God’s interactions to be scientifically detectable, and they would consider random mutations (in the tentative scientific sense without any metaphysical baggage) a perfectly apt description.
3 Likes
That’s a clear presupposition, and it can be said against testimony for a miracle today.
These 2 statements seem contradictory
We understand how DNA works quite well. What is harder to figure out is the exact function of all RNA’s and proteins and how their interactions result in the organism we see. We have made a lot of headway, but more work needs to be done.
No, it doesn’t. DNA is transcribed into RNA. DNA does not interact with ribosomes to make proteins. Ribosomes themsleves are part RNA and part protein, and in combination with tRNAs are responsible for messenger RNA sequence being transferred to amino acid sequence in the resulting protein.
We could discuss all of the long list of discoveries in embryonic development, but I’m guessing you could care less. The main point is that the difference between species is due to a difference in the sequence of bases in their DNA genome. Do you agree with this or not?
By accident? Who thinks that? There’s this thing called biological reproduction you should look into.
Added in edit:
Just for fun, here is an example chart for gene interactions.
A landscape of statistical genetic interactions.
(A ) Correlation network of genetic interaction profiles. Pearson correlation coefficients were computed for each pair of genes using the profile of all genetic interactions of these two genes to all other genes in all phenotypic features. An edge is drawn in the graph for each gene pair with correlation coefficient ≥0.6. Genes were placed by a graph layout algorithm (Fruchtermann–Reingold). Genes with similar genetic interaction profiles are proximal. The colour code depicts different biological processes that were separated by the correlation network. (B ) Subgraphs of the correlation graph shown in Figure 2 highlight the wiring within and between the annotated complexes.
3 Likes
I think the wording is conflating two different questions, leading to some miscommunication:
What are the biomechanical processes involved in using DNA to direct the making of proteins and RNA that then direct the building of organs? Although not every detail is worked out, much is known, and further investigation is fruitful - there is no sign of a chasm of mystery.
Why do DNA and proteins work as a good system for building life? It’s a variant of the basic anthropic principle question. In turn, despite claims to calculate probabilities by various sources, rival ill-founded ID and multiverse claims, etc., the answer to “do the patterns of natural laws point to an ultimate designer”?, when considered solely from a science-type viewpoint, is a matter of one’s personal judgement. “It looks unlikely to me to happen by pure chance at the ultimate metaphysical level” is a perfectly reasonable answer, but not scientifically verifiable. If one has other reasons for believing in God, then naturally one will affirm that He is able to form the laws of the universe as He sees fit.
But again, the fact that God did design the laws of nature such as to be suitable for producing living things, a study of those laws does not turn up mysterious gaps, but rather the fact that new kinds of organisms can be produced through these “natural” processes.
2 Likes
No need to be picky. I was trying to forstall the "we know how DNA works, whe you are just talking the basic mechanics. Once you have the amino acids…
You are still working on it.
Yet you still keep on and on about DNA mapping.
Obviulsy there will be differing DNA for different animals. That is a given. But comparing the sequences when you do not know exactly what hapeens is still fishing… Like I said you could l be comparing a recipe for madeira with a blueprint for a skyscraper. Their purpose is the same but the mechanics and composition are miles apart…
Oh, sorry, I am talking conceptions again.
Just to make sure you realise that I have answered this.
It is not the main point by a longway. it is your main point but not mine.
Aw give me a break! ToE is based on chance (Accident) there is no designer so there is no one to construct a code… You would accuse YECs of lying here.
That is just posturing. Yes we know…
I do not doubt what you know, it is what you do not know that you are trying to camoflage/
You have a map but you do not have the ledger to understand it. t would be like having a map of the world but not knowing if it was politacal (Coutries) or geo;ogical (strata) or meteorological (Weather systems)
The basi look is the same but the details are vastly different.
(More concepts and analogies, sorry, it is how I work.)
One day you will undersgand why we cannot communicate properly. it is because you start from data and I start from concepts. It would appear that the two approaches are incompatible.
Richard
Yes, I think there may be a conflation here of abiogenesis and ToE. I see a lot of misunderstanding of ToE as a theory about origins.
As I understand it, science is a long way from explaining the origin of complex systems of molecules such as DNA and RNA from “natural” processes. However, I think there is great value in studying abiogenesis, and attempting to understand as much as possible. Even if science did explain in detail a plausible way for the building blocks of life to develop from natural processes, I see no reason why people of faith should be alarmed. Most faith statements on Creation have God the Creator as eternally existent and separate from the creation, so ultimately the building blocks of the Creation were created ex nihilo “out of nothing”. There will never be a scientific explanation for that.
2 Likes
Fishing for what? We don’t need to know what a stretch of DNA does in order to compare the sequence of bases between species. In fact, about 90% of the human and chimp genome has no selectable function, so most comparisons are going to involve DNA that has no function.
The ToE is based on natural selection. Selection is the opposite of chance.
The ToE is also based on biological reprodution. It isn’t an accident that your DNA is the same as your parents, except for the handful of mutations that are unique to you.
You start from uninformed intuition and I start from almost 30 years of knowledge being a biologist. That’s the difference. I would be at the same disadvantage if we were talking about electrical engineering or music theory.
Here is a comparison of some DNA from the human and chimp genomes:
102836535 acacagccagattccaggttacagggttattctgcttccgatcagataaa 102836584
>>>>>>>>> |||||||||| |||||||||||| |||||||||||||||||||||||||| >>>>>>>>>
098675847 acacagccaggttccaggttacaaggttattctgcttccgatcagataaa 098675896
102836585 ttctccacttgcttggaaactctcatcacctatttctttcttccccaaaa 102836634
>>>>>>>>> ||||||||||||||||||||||| |||||||||||||||||||||||||| >>>>>>>>>
098675897 ttctccacttgcttggaaactctaatcacctatttctttcttccccaaaa 098675946
102836635 atcctcctcccttttccctgcattgcagcctaggaagcacagcaactatt 102836684
>>>>>>>>> |||||||||||||||||||||||||||| ||||||||||||||||||||| >>>>>>>>>
098675947 atcctcctcccttttccctgcattgcagtctaggaagcacagcaactatt 098675996
102836685 tcaaaacaccaggggaccctttagtgctctgcaaacatggtgatcaggtt 102836734
>>>>>>>>> ||||||||||| ||||||||||||||||||||||||||||||||||||| >>>>>>>>>
098675997 tcaaaacaccacaggaccctttagtgctctgcaaacatggtgatcaggtt 098676046
102836735 acctttcaataaagatcatcagcctccacttccttaccttgagtagaaaa 102836784
>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
098676047 acctttcaataaagatcatcagcctccacttccttaccttgagtagaaaa 098676096
102836785 caaaatctttttttttttttaaactttgggcacatggaaaggtaagtatt 102836834
>>>>>>>>> |||||||||||||||||| || ||||||||||||||||||||||||||| >>>>>>>>>
098676097 caaaatctttttttttttata--ctttgggcacatggaaaggtaagtatt 098676144
102836835 tgcaaatgactggcatgggcaatgactgacaactcaggaaagacagacaa 102836884
>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||| ||| >>>>>>>>>
098676145 tgcaaatgactggcatgggcaatgactgacaactcaggaaagacaggcaa 098676194
102836885 aaaatctccctgggaattagtagcagcaataagatagggtggaggagaag 102836934
>>>>>>>>> ||||||||||||||| |||||||||||||||||||||||||||||||||| >>>>>>>>>
098676195 aaaatctccctgggagttagtagcagcaataagatagggtggaggagaag 098676244There are 11 base differences between the two genomes, 9 substitution mutations and one insertion/deletion (i.e. indel). This gives us an overall similarity of 97.25%.
Why would I need to know the function of the DNA in order to do this comparison?
6 Likes