DNA barcoding: According to their kinds


(Martin R) #63

i never said that … these are secular scientists.

How could they questioning evolution?

However, the authors of the paper ask:

“What evolutionary mechanisms account for synonymous clusters being largely coincident with species?”

and i would also like to know…


(Martin R) #64

why do you ask? is it somehow important what language do i speak ?


(Martin R) #65

alright Steve, this is a fair answer. If it is true…


(Stephen Matheson) #66

They’re not. You have misunderstood. I think you spend more time typing on this forum than you do reading to understand the topics you write about.


(Haywood Clark) #67

As I noted before and you have ignored, you’re dealing with words, not evidence. Try dealing with the actual sequences amplified for the barcode and see if the evidence supports your claim. Or, more simply, answer the questions:

And between you and a chimpanzee?

If you haven’t derived your claim from the evidence, you have no basis for making your claim.

Aren’t engineers supposed to be big on measurements?


(Haywood Clark) #68

So that I can find papers in your native language, because you clearly don’t understand the English.


(Martin R) #69

thank you, you are very kind…i looked already. Nothing there…


(Martin R) #70

wikipedia:

Identification of birds

In an effort to find a relationship between traditional species boundaries established by taxonomy and those inferred by DNA barcoding, Hebert and co-workers sequenced DNA barcodes of 260 of the 667 bird species that breed in North America (Hebert et al. 2004a[35]). They found that every single one of the 260 species had a different COI sequence.

let me repeat:

They found that every single one of the 260 species had a different COI sequence.

The notion of the uniqueness?


(Martin R) #71

Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences.

The complete mitochondrial DNA (mtDNA) molecules of Homo and of the common chimpanzee were sequenced. Each sequence was established from tissue of one individual and thus nonchimeric. Both sequences were assembled in their entirety from natural (not PCR amplified) clones. Comparison with sequences in the literature identified the chimpanzee specimen as Pan troglodytes verus, the West African variety of the species. The nucleotide difference between the complete human and chimpanzee sequences is 8.9%. The difference between the control regions of the two sequences is 13.9% and that between the remaining portions of the sequences 8.5%. The mean amino acid difference between the inferred products of the 13 peptide-coding genes is 4.4%. Sequences of the complete control regions, the complete 12S rRNA genes, the complete cytochrome b genes, and portions of the NADH4 and NADH5 genes of two other chimpanzee specimens showed that they were similar but strikingly different from the same regions of the completely sequenced molecule from Pan troglodytes verus. The two specimens were identified as Pan troglodytes troglodytes, the Central African variety of the common chimpanzee.


(Martin R) #72

a while ago you taught me English…

I came across DNA barcoding when this article was published:

It brought my attention, so i wanted to know what a DNA barcode is. Then i learned that 90% animals have an unique 600bp DNA sequence in their mitochondrial genome …


(Martin R) #73

Software quality assurance ?


(Martin R) #74

hello again,

i admit, i have a lot of troubles with understanding evolutionary theory, especially, how it works. I have seen a lot of stuff, a lot of it don’t make sense in the light of the theory (e.g. convergent evolution or evolutionary stasis) … i have also heard from you guys a lot of very very very absurd stories - not easy to believe when you are a 21st century engineer … so i admit, i don’t understand, but i keep trying…

However, it seems i am not the only one who has troubles with understanding evolutionary theory.

Have you heard of the THIRD WAY ? It is a project launched by prof. James A. Shapiro and Denis Noble. Launched in 2014. There are lots of other people behind this project. Please note, these guys are secular scientists, they do not doubt evolution, they just think it works in very different way as taught today, they almost sound like Intelligent design advocates (they are not, there is a disclaimer on their website)

their official website:

http://www.thethirdwayofevolution.com/

Prof. Shapiro sits in the same building with Jerry Coyne. Is it not strange? Two colleagues and such radical different views on evolutionary theory?

Now, some quotes from the THIRD WAY website:

“The vast majority of people believe that there are only two alternative ways to explain the origins of biological diversity. One way is Creationism that depends upon intervention by a divine Creator. That is clearly unscientific because it brings an arbitrary supernatural force into the evolution process. The commonly accepted alternative is Neo-Darwinism, which is clearly naturalistic science but ignores much contemporary molecular evidence and invokes a set of unsupported assumptions about the accidental nature of hereditary variation.”

"Neo-Darwinism ignores important rapid evolutionary processes such as symbiogenesis, horizontal DNA transfer, action of mobile DNA and epigenetic modifications. "

and, here is quite a radical view on Natural Selection:

“Moreover, some Neo-Darwinists have elevated Natural Selection into a unique creative force that solves all the difficult evolutionary problems without a real empirical basis. Many scientists today see the need for a deeper and more complete exploration of all aspects of the evolutionary process.”

or

" The DNA record does not support the assertion that small random mutations are the main source of new and useful variations. We now know that the many different processes of variation involve well regulated cell action on DNA molecules."

etc…

So, these guys seem to be confused too …

So now we have: Creationists, Neo-Darwinists, and the Third Way… great!


(Martin R) #75

Bill, i forgot, there is one more thing… could you do me a favor?

You should already know, my English is bad, please could you stop using short forms? You think i know what QA stands for? or BSEE, MSCS ?

I have looked it up, but anyways. You were correcting my every word, so please stop using short forms… if you can… it would help…


#76

Martin, one helpful way to understand is to look at an analogy between evolutionary biology and embryology. Would you find it easy to believe that a zygote (two fused gametes) could develop through biological processes into a fully formed baby?

Even for many of us with graduate education in embryology, this sounds preposterous and hard to believe. And yet it happens.

Biology addresses the mechanisms. Theology addresses the meaning (Psalm 139:13).


(Martin R) #77

Jason… i don’t want to be rude, especially to you brother.

However, you got it all wrong.

Development in biology has nothing to do with evolution… you guys have it all wrong…
you guys will never understand what you are looking at … 150 years gone, and you still don’t get it…

A cell is a very advanced bio-technology. We engineers can recognize it. It is a engineering SCIFI. A cell is like a very advanced 3D printer. The cell develops all the parts, all the materials … everything…

Lets take for example a stupid 3D printer.

You need to load a program … you need a filament … if the filament is out, you have to replace it and add a new one. You need to plug the printer into an electrical outlet in order to print … and so on…

Then have a look at the cell-technology… it is an engineering SCIFI… fully autonomous ‘printing’ of 3D objects ( sometimes extremely big and heavy e.g. blue whale) , moreover, these objects are fully autonomous, self-navigating, run, jump, swim, fly!, dive, and i don’t know what else… a cell is a engineering SCI-FI … jason, you obviously can’t recognize it, i don’t blame you. But we engineers can… most of us … (here is another engineer, Bill, but he can’t)

Jason, i already tried to explain to you few days ago, but, obviously, i have to again:

Most people don’t realize, there are at least 3 layers of design:

  1. the design of the species itself: e.g. a hummingbird (shape of the body, wings, internal organs)
  2. the design of the species’s development: the step-by-step process of self-assembly, because a hummingbird self-assembles… there are no assembly workers, nor parts / materials suppliers…
  3. the materials (you need to design all the materials used, to mix chemicals under right conditions. And we see a lot of sophisticated materials in the nature, e.g. feathers, bones, eye’s cornea or lens, muscles, skin, hair, teeth, like thousands of hi-tech materials which are almost impossible to replicate even in 21st century …)

p.s.
Jason, you wrote “Would you find it easy to believe that a zygote (two fused gametes) could develop through biological processes into a fully formed baby?”

indeed, it is very advanced technology - engineered. …designed… That is why 21st century scientists have such big troubles to develop an artificial cell from scratch, or, to explain the origin of life. That is the reason… it is a very advanced technology, which is obviously not so easy to reverse-engineer and replicate…


#78

Friend, in Christian charity, I give you the benefit of the doubt that you are here to learn and exchange ideas rather than try to score points for intelligent design theory (IDT). I’m thinking we need to do a thread to demonstrate how IDT is a flawed approach to science.

I agree with you that a human infant is designed, that “God knit me together in my mother’s womb.” But no one can prove or disprove this belief using the scientific process. Does this mean embryology is a farce? By no means. Wouldn’t you agree with me that God uses biological mechanisms to develop a zygote into a fully grown baby?

Biological mechanisms are only analogous to the technological mechanisms that you deal with as an engineer. You may benefit from sitting with a biology textbook to understand the evolutionary mechanisms before trying to “poke holes” in the theory. For 150 years, scientists have tried to disprove evolutionary science. This is how the scientific process works.


(Haywood Clark) #79

Why not tell me your native language so that I can look? You’re clearly missing a lot.


(Haywood Clark) #80

Cutting and pasting does not suggest that you are understanding, particularly since you are cutting and pasting about the entire mitochondrial genome, not the small barcode sequence.

So, let’s try. Is this sequence therefore UNIQUE in the way you are claiming it to be? Do any of these data present a problem for evolutionary theory?


#81

First off, it is species that have unique DNA sequences in this region. Many individuals within the same species will have identical DNA sequences in this region. What the paper is saying is that the DNA sequence shared by many indivuals in the species can be traced back to a single individual who lived in the last several hundred thousand years.

Just so people can see at least one comparison . . .

I found a COI database here:

http://www.barcodinglife.org/index.php

I searched for a human COI and then used BLAST to search against the chimp genome. This is what the comparison looks like (query = human).

Query  1     ATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCA  60
             |||||||||||||| ||||||||||||  ||||||||||||||||||| |||||||||||
Sbjct  7951  ATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAGGCTTACCCGCCGCA  8010

Query  61    GTACTGATCATTCTATTTCCCCCTCTATTGACCCCCACCTCCAAATATCTCATCAACAAC  120
             ||||||||||||||||| ||||||||| ||  |||||| || ||| ||||||||||||||
Sbjct  8011  GTACTGATCATTCTATTCCCCCCTCTACTGGTCCCCACTTCTAAACATCTCATCAACAAC  8070

Query  121   CGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGATAGCCATA  180
             |||||||| ||||||||||||||||||||  |||| |||||||||||||| ||| | |||
Sbjct  8071  CGACTAATTACCACCCAACAATGACTAATTCAACTGACCTCAAAACAAATAATAACTATA  8130

Query  181   CACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTGCC  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct  8131  CACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTACC  8190

Query  241   ACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATCTATA  300
             ||||| || || |||||||| || || |||||||| ||||||||||||||||||||||||
Sbjct  8191  ACAACCAATCTTCTCGGACTTCTACCCCACTCATTCACACCAACCACCCAACTATCTATA  8250

Query  301   AACCTAGCCATGGCCATCCCCTTATGAGCGGGCGCAGTGATTATAGGCTTTCGCTCTAAG  360
             |||||||||||||| |||||| ||||||| ||||||||  | ||||||||||||| ||||
Sbjct  8251  AACCTAGCCATGGCTATCCCCCTATGAGCAGGCGCAGTAGTCATAGGCTTTCGCTTTAAG  8310

Query  361   ATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATA  420
             | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  8311  ACTAAAAATGCCCTAGCCCACTTCTTACCGCAAGGCACACCTACACCCCTTATCCCCATA  8370

Query  421   CTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTA  480
             |||||||| |||||||| || |||||||||||||||||||||||| | |||||||| |||
Sbjct  8371  CTAGTTATCATCGAAACTATTAGCCTACTCATTCAACCAATAGCCTTAGCCGTACGTCTA  8430

Query  481   ACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCA  540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct  8431  ACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACACTAGCA  8490

Query  541   ATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACT  600
              ||||||| || || || |||||| |||| || ||||||||||||||||| |||||||||
Sbjct  8491  TTATCAACTATCAATCTACCCTCTGCACTCATTATCTTCACAATTCTAATCCTACTGACT  8550

Query  601   ATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTC  660
             || ||||| ||||| |||||||||||||||||||| ||||| ||||||||||| ||||||
Sbjct  8551  ATTCTAGAGATCGCCGTCGCCTTAATCCAAGCCTATGTTTTTACACTTCTAGTGAGCCTC  8610

Query  661   TACCTGCACGACAACACA  678
             ||||||||||||||||||
Sbjct  8611  TACCTGCACGACAACACA  8628

Overall, there is 92% similarity between the human and chimp sequence. If memory serves, mtDNA accumulates mutations at a higher rate than autosomal DNA which is why it is useful for differentiating between closely related species.


#82

Bad comparison. 3D printers don’t reproduce.

What separates life from human engineering is reproduction. It is the ability to reproduce in combination with evolution that produces the designs you are seeing.