There is no room for God in ToE,
My reasoning assumes that God is not part of evolution.
If God is part of evolution then He supplies the intelligence I need to be there.
You have never given a place for God other than as the instigator. ToE is self sufficient.
Richard
And yet you consistently reject the text and its meaning when you talk about the Hebrew scriptures!
I will remind you again that long, long before Darwin scholars of Hebrew concluded that the Creation is millions, billions, or even a trillion years old, and to them it was just as “clear” to them as your doctrine is to you. Do you think the word of the Lord has only come to you? Do you think you know more than the scholars who concluded back in the eighth and tenth centuries that Genesis 1 tells us that the universe started out smaller than a grain of mustard and is unimaginably old?
That comes from Genesis according to many, many faithful scholars even before Galileo looked at Jupiter in a telescope.
I don’t understand their reasoning, but then I only had six years of ancient Hebrew.
Which reminds me – how many years have you had?
The point is that the spider doesn’t have to.
Tell me: when someone pokes your knee in the right place, how do you decide whether or not you will kick your foot out?
I do not agree.
The Cantor infinities is good example of the rationality of infinity – showing that there are different orders of infinity and they can be compared to one another.
That is not true. It is certainly how I understand God. But other people do not define God this way.
Since I have rejected your premise, this does not follow. Nor do I think God should be described as irrational – not according the meaning I am using when I say there is no such things as the irrational which is real. What I mean by the word is logical inconsistency and rational incoherence. Nor do I believe we are incapable of understanding God, not given an eternity. It is the same as our parent-child relationship with God. We are made to become like Him even though it will take forever to do so. I believe this is the essence of eternal life – where there is no end to what God can give and no end to what we can receive from Him. It is why eternal life requires a relationship with God.
Modern birds have over 120 million years to develop refinements in flight and eliminate extras. They also learn and improve their flight skills. Evolution doesn’t have to produce idealized forms instantly. Good enough to survive is all that is needed, and the first step in a new direction is one step ahead of no steps in that direction. Archaeopteryx didn’t have to compete with modern birds, just with insects and pterosaurs, both of which had quite different lifestyles.
Is flipping a coin random? Mathematically, our best description of its behavior is probabilistic. But I might be flipping a coin for a specific purpose. No amount of scientific analysis of the coin or the laws of physics governing its motion will detect the purpose behind the action.
Reminds me of a guy a YECer was ‘witnessing’ to on my university campus. He insisted that God made the Bible understandable by a six-year-old. The guy being ‘witnessed’ to said, “I don’t need a god who wants me to be stupid”.
To say He needs more than that is to say He is incompetent.
That is just you imposing your need for ToE to work.
I guess if you believe God works miracles…
No.
ToE has nothing to do with God. It assumes He just left the world to rot or thrive without a care. He sits on the sidelines in retirement. That is not the God I worship.
The fact is ToE cannot work without active intelligence. That is not a slur on God, it is a slur on those who think God didn’t continue His creative work past the big bang.
You underestimate what Creation is or entails.
Science cannot see God, but that does not mean He is dead, or inactive.
Richard
Dear Roger,
thank you for your thoughts, I agree with much of what you say, however there are parts I struggle to comprehend what exactly you are meaning and there are other parts that in my journey in this world, I understand differently to you. I have a science background, I am not suggesting that anyone should dumb down science to prove anything, the point I was making is that the Bible is inspired by God, and God has made absolutely certain that His important message to us all about the historical events of creation are ever so plain, and clear, and easily understood that a young child can even understand what occurred.
Of course the Bible isn’t God, I have never stated otherwise, the Truth is the Bible is God’s inspired Word to us all throughout this present age.
Yes, Jesus is The Word, He is also The Creator, The Son, The Logos, He is God, the Holy Trinity is One God and yet He is three persons.
Didn’t Jesus say to Philip:
“9 Jesus saith unto him, Have I been so long time with you, and yet hast thou not known me, Philip? he that hath seen me hath seen the Father; and how sayest thou then, Show us the Father?” . . . John 14:9 KJV
Why do you believe that God has gone to so much effort to be absolutely clear about the length of each of the days of creation. I’ll tell you what I believe is likely why, and that is because He is Omniscient, He knew before the foundation of the world that some people will try to discredit the accuracy of the Bible with the agenda of inserting the atheist belief of evolution into the historical account of creation that He so clearly spelled out for us all to see:
1 In the beginning God created the heaven and the earth.
2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters.
3 And God said, Let there be light: and there was light.
4 And God saw the light, that it was good: and God divided the light from the darkness.
5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.
6 And God said, Let there be a firmament in the midst of the waters, and let it divide the waters from the waters.
7 And God made the firmament, and divided the waters which were under the firmament from the waters which were above the firmament: and it was so.
8 And God called the firmament Heaven. And the evening and the morning were the second day.
9 And God said, Let the waters under the heaven be gathered together unto one place, and let the dry land appear: and it was so.
10 And God called the dry land Earth; and the gathering together of the waters called he Seas: and God saw that it was good.
11 And God said, Let the earth bring forth grass, the herb yielding seed, and the fruit tree yielding fruit after his kind, whose seed is in itself, upon the earth: and it was so.
12 And the earth brought forth grass, and herb yielding seed after his kind, and the tree yielding fruit, whose seed was in itself, after his kind: and God saw that it was good.
13 And the evening and the morning were the third day.
14 And God said, Let there be lights in the firmament of the heaven to divide the day from the night; and let them be for signs, and for seasons, and for days, and years:
15 And let them be for lights in the firmament of the heaven to give light upon the earth: and it was so.
16 And God made two great lights; the greater light to rule the day, and the lesser light to rule the night: he made the stars also.
17 And God set them in the firmament of the heaven to give light upon the earth,
18 And to rule over the day and over the night, and to divide the light from the darkness: and God saw that it was good.
19 And the evening and the morning were the fourth day.
20 And God said, Let the waters bring forth abundantly the moving creature that hath life, and fowl that may fly above the earth in the open firmament of heaven.
21 And God created great whales, and every living creature that moveth, which the waters brought forth abundantly, after their kind, and every winged fowl after his kind: and God saw that it was good.
22 And God blessed them, saying, Be fruitful, and multiply, and fill the waters in the seas, and let fowl multiply in the earth.
23 And the evening and the morning were the fifth day.
24 And God said, Let the earth bring forth the living creature after his kind, cattle, and creeping thing, and beast of the earth after his kind: and it was so.
25 And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.
27 So God created man in his own image, in the image of God created he him; male and female created he them.
28 And God blessed them, and God said unto them, Be fruitful, and multiply, and replenish the earth, and subdue it: and have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moveth upon the earth.
29 And God said, Behold, I have given you every herb bearing seed, which is upon the face of all the earth, and every tree, in the which is the fruit of a tree yielding seed; to you it shall be for meat.
30 And to every beast of the earth, and to every fowl of the air, and to every thing that creepeth upon the earth, wherein there is life, I have given every green herb for meat: and it was so.
31 And God saw every thing that he had made, and, behold, it was very good. And the evening and the morning were the sixth day. Genesis 1 KJV
I do not understand why a straightforward reading of Genesis 1 (looking neither to the right or left), but believing in faith what is plainly written must be discredited by those with ‘other agendas’.
It is those ‘other agendas’ that contrive convoluted explanations to discredit what God ensured is clearly written, to enable evolutionary dogma of alleged billions of years of suffering and death that sadly, eventually lead many away from the Truth.
I do not know anyone involved in Creation ministry that rejects science; the claim of rejecting science is leveled at those of us that believe the Bible as written by some on this website but it is a false claim, used to discredit genuine Christians who believe the Bible in faith.
I have never stated that:
Why do you think that?
Of course all Truth is not revealed in Genesis.
The Truth resonates with Christians indwelt by the Holy Spirit. He makes the Scriptures come alive and reveals as is needed by the person, understanding too profound for words at times.
I must disagree here, evolutionary change is a myth.
Yes, there is change but it is limited change, that’s all.
We never see evidence of the type of change that is demanded by Big picture evolution if it truly were a real process in the microbes to mankind sense, and that is because it never happened.
All we ever see is evidence of fine tuning of individuals within a kind or a species through Natural Selection from existing genetic information, nothing more.
Of course, such small changes within a kind are claimed as evolution, but that is precisely where the deception lies.
Through an inadequate understanding of the scientific reality, that lack of knowledge is exploited by the paradigm itself, so that many are deceived into believing the false teachings of evolution and billions of years.
I do not see myself as any better than anyone else, and I know that people who reject the false teaching of evolution in this world are ridiculed if they proclaim they are Bible believing Christians.
I am but nothing, my Lord Jesus is Who is important, I know He loves me, though I do not deserve anything, His love sustains me and I marvel at His Glory, the only begotten Son of the Father Who is One with Him and the Holy Spirit, the One and Only Living God.
Yes, Praise His precious Name, Glory in the Highest, Hallelujah! Jesus Is Lord of All.
God bless you Roger,
jon
Ok this is the critical point I think. A set is a way to partially rationalise the infinite. For example God is a set of infinite attributes. But those infinite attributes cannot ever fully be comprehended. Just like Pi is a verbal set that partially rationalises an infinite non repeating real number. The object of the infinite polygon is verbalised as a circle. The infinite concept is contained in a verbal set.
The other language would be potential infinite vs actual infinite. A set is the only way to talk about the infinite without comprehending the whole (which is impossible).
I agree, I am equating irrational and transcendent. In a positive view Irrationality is transcendent. In a negative view irrationality is absurdity, in common language the negative view is what most people see, so the way i am using irrational in the irrational and real category would be a positive view / transcendence.
see what you think about this quote/article
“If we can permit God to be predicated as a transfinite number, or in other words, the infinite set, then it becomes possible to assert that God is an infinity bounded by himself, and is both infinitely transcendent and limited and inherent, without transgressing into a logical contradiction. Cantor’s mathematics provides us with a language to explain one of the most fundamental issues in theology without transgressing into a logical contradiction.” Ochiai Hitoshi. (2014) “Theology Of Georg Cantor”. Apeiron Centre, web article
https://apeironcentre.org/theology-of-georg-cantor/
If you have time see what you understand this article to be suggesting
thanks
How do you explain how birds have an innate ability to fly?
This should be interesting.
That’s just semantics, not science. If you are arguing over the meaning of words then you are missing the boat. Science is based on data, not definitions.
There is nothing in natural selection that implies evaluation or choice. People who are lactose tolerant didn’t choose to be tolerant. They were born with one of several mutations that confer lactose tolerance, a mutation they had no choice in. There is no natural intelligence that scans the genomes of each newborn to find out if they have that mutation. Rather, those born with the mutation for lactose tolerance survived and reproduced at a higher rate in the past which is why these mutations are among the most strongly selected mutations in the human population.
Why can’t mutations be called neutral? Because you say so?
That’s natural selection.
You haven’t demonstrated how anything I have written is incorrect. All you seem to do is use semantics to try and describe known and well understood evolutionary processes in non-standard ways. It’s still the same thing.
Complex specified information is just empty rhetoric. You have no intention of ever quantifying it in any meaningful biological sense. For example:
A CTCATTCACTAGGTTGCGAAGCCTATGCTGATATATGAATCCAAACTAGAGCAGGGCTCT 60
B CTCATTCACTAGGTTGCGAAGCCTATGCTGATATATGAATCCAAACTAGAGCAGGGCTCT 60
************************************************************
A TAAGATTCGGAGTTGTAAATACTTAATACTCCAATCGGCTTTTACGTGCACCACCGCGGG 120
B TAAGATTCGGAGTTGCAAATACTTAATACTCCAATCGGCTTTTACGTGCACCACCGCGGG 120
*************** ********************************************
A CGGCTGACAAGGGTCTCACATCGAGAAACAAGACAGTTCCGGGCTGGAAGTAGCGCCGGC 180
B CGGCTGACAAGGGTCTCACATCGAGAAACAAGACAGTTCCGGGCTGGAAGTAGCGCCGGC 180
************************************************************
A TAAGGAAGACGCCTGGTACG 200
B TAAGGAAGACGCCTGGTACG 200
********************There’s just one difference between those sequences. Does one sequence have more information than the other? What is the quantity of complex specified information in each?
I never said I had an answer, only that it would be the height of improbability for it to be an accident, yet there is no other explanation within ToE.
Autonomous processes are difficult to explain. Could there be DNA codes for them? I am not sure that comes under the remit for DNA. In humans walking is learned before it becomes second mature, but flying? I guess the modern birds have the muscles in the right place so it is comparatively simple but how those muscles etc found the right place through evolution? That would seem to be a greater fluke than the shape of humanity, .if the motion needed is anything to go by.
So this is my crit. How such things could end up, in the right place, complete with nerve control?
(You understand I am talking about inception, not modern inheritance)
Richard
We don’t even have to consider the ToE for the moment.
It sure seems to me that the ability to fly is innate in birds. They are able to fly without any training. They hop out of the nest and are able to fly. This ability appears to be heritable. If it’s heritable that would point to DNA.
Natural selection. Those that end up in the right place are selected for.
That is just trite. How many million failures would you guess at?
Can’t you see that it is just not plausible? Let alone the motivation to jump.
There is no halfway house, in fact there is nothing short of perfection. One tendon out of place and the thing plummets. How many failed attempts would it take?
Concepts such as up & down, Flying, falling, gliding feathering out and so on, they are all human imposed onto what is seen. There is no evidence that most of nature has ths sort of cognisance or self-awareness.
Even instinct has to be learned somewhere along the line. Is heart regulation controlled by DNA?
Richard
How many millions of good changes?
Why, because you say so?
You’ve already been shown the halfway houses. That you refuse to acknowledge reality is not my problem.
There is no evidence that you would accept, as shown by most of your posts.
By definition, instincts are behaviors that aren’t learned, such as flying in birds.
FCOL there has to be a first time! When there is no heredity, no example, no teacher!
You just can’t see it! (Or don’t want to)
You have shown a few feathers and a thing with full wings.
You have acomputer simulation of this winged thingy climbing and then gliding back down complete with featherng out landing.
You cannot show the motivation. You cannot even conceive the motivation
You don’t want to see the details.
Just give it enough time!
Simple, trite and naive.
Richard
There are mutations.
We have shown fossils that are clearly like non-avian dinosaurs, complete with claws and long tails. These are well outside of what you proclaim to be “perfect”, and yet there they are.
It’s the same motivation that allows new birds to fly, or newly born gazelles to get up on all fours and start running.
I gave an example of how infinity is susceptible to rational analysis and you have not given any example of logical inconsistency or rational incoherence in the idea of infinity. The fact is that infinity is routinely used in mathematical analysis with infinite series and sums. I see nothing partially rational about it. It is a rational construct and thus rationality is its very essence. I suggest that you are defining both rationality and infinity in a way which has little connection with the scientific uses of the word and are therefore very difficult for me to me to understand in any way.
No. God is not a set of anything. God is a unity. And there is this principle of simplicity: there is nothing which is not God which makes God be God. If we divide God into parts that is rational construct which only exists in our rationality and not in God.
LOL… The digital formulation is just a way representation not the essence of a number and you give too much significance to the capability of representing a number as a ratio of integers. The numbers can and have been written and explained in a finite way using different methods of representation. For example methods of calculating all the digits of an irrational number are finite and thus that give a finite way of representing the number.
That is not good communication. We already have the word “transcendent” for this meaning and “irrational” has a completely different meaning which is also quite useful for many things. It is not helpful to remove one of them and makes for dishonest arguments excluding perfectly rational and meaningful options by mere twists of rhetoric.
Lets compare this with something I do. I assert that the difference between living organisms and machines is that the former are products of self-organization while the latter are products of design. Some have objected that the “word” design has a wider usage than this, for example in what we call genetic design where we breed or even manipulate DNA to mix traits from different organisms, or even by using evolutionary algorithms and AI to come up with new designs. But in this is just quibbling over terminology because the distinction described remains whether there is a spectrum between them or not. After all, I believe in abiogenesis which is predicated upon there being a spectrum between life and non-life. It doesn’t erase the difference any more than a spectrum between yellow and blue means there is no difference between yellow and blue.
And you know that because?
You are imposing human rationale onto innocent Nature.
You are not even attempting to think without human conceptualisation… Perhaps you can’t?
Richard
“Let your conversation be always full of grace, seasoned with salt, so that you may know how to answer everyone.” -Colossians 4:6
This is a place for gracious dialogue about science and faith. Please read our FAQ/Guidelines before posting.