That was an excellent summation on the complications of comparing genomes!!! Best I’ve seen … and incredibly concise…I didn’t have to sit and read an article for 45 minutes!..
[Youtube URL for Comparing Chimp Genome: https://youtu.be/IbY122CSC5w](Youtube URL for Comparing Chimp Genome: https://youtu.be/IbY122CSC5w)
I don’t think you understand the difference between sequencing and assembly, nor how whole genome shotgun methods work.
What they did with the initial chimp sequence is physically chop up the genome into random chunks that were hundreds of bases long, and then sequenced those little chunks. If you do this for many copies of the genome you get chunks of sequence that over lap each other. For example, let’s say I had these chunks of a sentence:
The little
brown fox jumped
little brown fox
jumped over the
over the white
the white fence
fence over the
over the hill.
By overlaying the common words I can rebuild the whole sentence:
The little brown fox jumped over the white fence over the hill.
The little
little brown fox
brown fox jumped
jumped over the
over the white
the white fence
fence over the hill.
That is how the whole genome shotgun method works, in essence. The tough part is assembling all of the tiny pieces into the larger whole, and that is where they used the human genome as a backbone to help put those pieces together. Think of it as using an already assembled jigsaw puzzle to help put together another jigsaw puzzle that is 98% similar. By comparing the puzzles you have a good starting point for figuring out where the sequences fit together.
The important thing here is that they are not changing the actual sequence reads from the chimp genome to match those in the human genome. They are simply using the human genome to figure out how the small chunks of chimp sequence fit together.
When scientists say that certain sequence could not be aligned or assembled they are saying that they don’t know where that chunk of sequenced DNA fits into the larger genome. When you are comparing two genomes from two species you want to compare DNA that is orthologous, so if you don’t know where DNA reads fit into the larger genome then you can’t compare them, even if two chunks of unaligned sequence match 100%. Like realty, it is all about location, location, location. You can’t compare DNA if you don’t know where it fits into the genome.
Repetitive DNA is notoriously hard to align because there are many places where the DNA chunks can overlap. For example:
These two chunks could over lap like this:
ATTTATTTATTTATTTATTTATTTAGACCCGAGCGG
CCGAGCCATTTATTTATTTATTTATTTATTTA
like this:
ATTTATTTATTTATTTATTTATTTAGACCCGAGCGG
CCGAGCCATTTATTTATTTATTTATTTATTTA
like this:
ATTTATTTATTTATTTATTTATTTAGACCCGAGCGG
CCGAGCCATTTATTTATTTATTTATTTATTTA
There is no one unique way in which those two sequences align, so they are unaligned and kept out of a comparison between species.
I haven’t looked at the videos yet, but I am confident that they are clear enough. I thought I would try to explain the issues in my own words to see if that helped.
That is incorrect. Sequence is excluded because it isn’t aligned, not because it is different. Those are two different things. Think of it as having 3 pieces of a jigsaw puzzle that fit together, but you don’t know where in the larger jigsaw puzzle those 3 pieces fit. That is what unaligned sequence is. There may even be a 100% match between sequence that is not aligned in the chimp sequence and aligned sequence in the human genome, but those comparisons are not made because the chimp sequence is not aligned.
What this discussion has proved to me is that it is the least helpful of almost all the pro-evolution topics.
The kinds of assumptions that anyone has to make to come up with any kind of comparison is the kind of number that only a scientist would appreciate.
It’s useless when applied to any YEC I can think of…
If we are talking about whole genome comparisons, it does become a bit complicated. How do we determine what is orthologous, homologous, paralogous, or novel? Why do they list the differences due to substitutions separate from indels? Comparing specific genes or specific sequences is a lot easier if we are discussing which conclusions or theories the evidence supports.
The only overarching theme I can really point to is that if you use the same method to sequence the genomes of humans and other apes and the same methods for comparing those genomes you will find that chimps share more DNA with humans than they do with other apes. If chimps, gorillas, and orangutans are in one group as determined by DNA, then humans are also in that group due to the pattern of shared DNA. Creationists tend to avoid this point.
I’m glad you brought it up and described it to me. I feel a little bit more prepared now.
This topic was automatically closed 6 days after the last reply. New replies are no longer allowed.
“Let your conversation be always full of grace, seasoned with salt, so that you may know how to answer everyone.” -Colossians 4:6
This is a place for gracious dialogue about science and faith. Please read our FAQ/Guidelines before posting.