A whopping 1.3 billion letters of sequenced, comparable DNA was excluded from the Genome comparison simply because it is different.
As far as the Chimp thing goes… Craig Venter said the same thing as me…
But what does he know?
Clint was the living reference point for millions of dollars’ worth of genetic code. One of the reasons he was chosen was his youth and clean bill of health: if researchers needed to take more tissue samples to validate the DNA sequence, he would be around to provide them. And as insights into the function of his genes emerged, they would be able to examine his morphology, behaviour and physiology.
But Clint has been put down aged just 24, New Scientist has learned. The Yerkes National Primate Research Center in Atlanta, Georgia, where Clint was kept, will not say what disease he was suffering from.
[content removed by moderator] [Do you] think that they randomly selected one single chimp to represent the entire species?
[Do you] think that Chimps who live to be 60+ years old, in captivity and were specifically tested to be healthy enough for further testing just die of unknown causes?
And for the record, the preservative methods used by the Genome Consortium conveniently failed.Their results can’t be questioned.
You seem to be confused here. So far, you’ve pointed to gene annotations taken from the human genome; they involved no modifications to the chimp genome. Then you pointed to the human-based assembly, which did indeed depend (fairly modestly) on the human genome. Now you’re pointing to an alternative to that assembly, that depended hardly at all on the human genome. As far as I know, the subsequent iteration didn’t depend at all on the human genome. So as you look at less and less dependence on the human genome, you become more and more outraged.
I have to say, for someone who claims to be here to learn, you sure do come across as having an axe to grind. [quote=“toocoolblue, post:7, topic:37047”]
Really…
The draft genome assembly—generated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomes—covers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases
Let’s do some math…What is 94% of 3.3 billion? Is it 2.4 billion?
[/quote]
No, it’s 2.7 billion. It’s talking about 94% of the euchromatic genome, which is (as you quote later) 2.85 billion base pairs long. But you don’t have to do any calculations: just look at Table 1. 2.7 billion bases of chimp sequence had consensus bases called and assembled. If you read the first Supplemental Note, you will find more details. 2.73 Gb of chimp sequence could be assembled into scaffolds. (And if it isn’t assembled, it might as well not exist.) Of that, 2.7 Gb had significant alignment to the human genome. After overlapping scaffolds were removed, there were 2.41 Gb of chimp sequence. Of that, 280 Mb aligned to parts of the human genome that weren’t assembled into chromosomes (because no one knew where they went), and a total of 91 Mb didn’t have an assigned location in the human genome. Given the quality of the chimpanzee genome (and to a lesser extent the human genome), most of that probably represents badly assembled sequence, but one never knows.
Mostly because the technology had gotten a lot better. But also because, no, it wasn’t produced to be as accurate. You do realize that the Human Genome Project cost something like 3 billion dollars, right? Do you really think there was a spare billion or two dollars lying around to sequence the chimpanzee genome to the same standard? [quote=“toocoolblue, post:7, topic:37047”]
It was produced to be a copy of the human genome.
They cherry picked the data and manipulated it to produce the answer they wanted to hear.
[/quote]
No, it was produced to be the best genome that could be produced for the available funds. And what answer that they wanted to hear? The whole point of the project – which involved a heck of a lot of work by a lot of people – was to learn what the chimp genome was like. [quote=“toocoolblue, post:7, topic:37047”]
Such as only using one cherry picked chimp to make up almost the entire chimp genome
[/quote]
Your accusations are going from the technical to the absurd. “Cherry-picked chimp”? What the heck could that possibly mean? Do you think they sequenced dozens of chimps and picked the one whose sequence they liked the best? [quote=“toocoolblue, post:7, topic:37047”]
and then killing that chimp so further tests can’t be conducted.
[/quote]
Oh my God! They murdered Clint! The bastards! [quote=“toocoolblue, post:7, topic:37047”]
Chimp aren’t even genetically similar to each other much less humans. In Africa, Chimps have shown more genetic diversity in 1 square mile area than in the entire human race.
[/quote]
Chimps have about twice the genetic diversity of humans. [quote=“toocoolblue, post:7, topic:37047”]
Telling people that Humans and Chimps are 99% genetically similar, while not telling them that you are ignoring 25% of the genomes, (the vast majority of which have been sequenced.) but are ignored because they DO NOT align with each other… is disgraceful.
[/quote]
Yeah. It’s also false. [quote=“toocoolblue, post:7, topic:37047”]
I have considered the possibility, and I have no doubt they knew the fraud they were committing. And shame on you for trying to defend them.
[/quote]
It’s much worse than that: I’m one of them. Just what mysterious conclusion was it you think we wanted to come to, and why would we go to so much trouble and expense to reach it? You surely don’t think we were doing it to fool creationists, do you? Because we weren’t thinking – or talking – about convincing creationists, or of proving to the public that humans and chimpanzees were related. Not at all. Ever. It’s hard to convey just how little working geneticists care about creationists. We sequenced the genome to use it. That’s the only reason we would have bothered.
Are you serious!?!? This is nowhere NEAR the most outrageous case of scientific fraud in the history of science. Surely you know that all 6 of the moon landings were faked, on sound stages and outdoor sets near where I grew up in Arizona. They got Stanley Kubrick to help. Despite all the evidence of fraud, billions of people still believe that humans landed on the moon and even drove go-carts around on it. The scientists are inexcusably complicit—I think something like 99.666% of them claim that the landings were real. What kind of science creates a “moon landing” and then merges the fake pictures from Flagstaff, Arizona with real images of the actual moon?
Next are you going to tell me that Hoover Dam was built to make a big lake in Arizona, and not to hide a gigantic extraterrestrial robot kept dormant by continuous streams of liquid nitrogen? Or that Mount Rushmore is “art” and not a subterranean storage depot for the riches of an extinct South American civilization? Please, at least tell me that you know that Elvis is alive on Easter Island, hunting lemmings with JFK.
Genome annotation is so nerdy and boring. I think you should stop scouring the internet for ATGGGCCA and start asking whether the spaceship concealed inside the Great Pyramid (that’s real science, dude!) was really unknown until just this week. No way.
Hey there, evil atheist scientist. Pyramid Christians are a thing, I tell you. It’s sort of a New Age/Christian syncretism. I had a conversation with one once. He believed that the Great Pyramid was built with such amazing, unique technology that the other pyramids don’t even compare. And that all this fantastic technical knowledge was lost in the flood. So suck it up, buttercup!
It’s also not true, by the way. The entire human population contains genetic variants at just about every site in the genome consistent with being alive. One group of chimps has far fewer variants.
That was an excellent summation on the complications of comparing genomes!!! Best I’ve seen … and incredibly concise…I didn’t have to sit and read an article for 45 minutes!..
I don’t think you understand the difference between sequencing and assembly, nor how whole genome shotgun methods work.
What they did with the initial chimp sequence is physically chop up the genome into random chunks that were hundreds of bases long, and then sequenced those little chunks. If you do this for many copies of the genome you get chunks of sequence that over lap each other. For example, let’s say I had these chunks of a sentence:
The little
brown fox jumped
little brown fox
jumped over the
over the white
the white fence
fence over the
over the hill.
By overlaying the common words I can rebuild the whole sentence:
The little brown fox jumped over the white fence over the hill.
The little
little brown fox
brown fox jumped
jumped over the
over the white
the white fence
fence over the hill.
That is how the whole genome shotgun method works, in essence. The tough part is assembling all of the tiny pieces into the larger whole, and that is where they used the human genome as a backbone to help put those pieces together. Think of it as using an already assembled jigsaw puzzle to help put together another jigsaw puzzle that is 98% similar. By comparing the puzzles you have a good starting point for figuring out where the sequences fit together.
The important thing here is that they are not changing the actual sequence reads from the chimp genome to match those in the human genome. They are simply using the human genome to figure out how the small chunks of chimp sequence fit together.
When scientists say that certain sequence could not be aligned or assembled they are saying that they don’t know where that chunk of sequenced DNA fits into the larger genome. When you are comparing two genomes from two species you want to compare DNA that is orthologous, so if you don’t know where DNA reads fit into the larger genome then you can’t compare them, even if two chunks of unaligned sequence match 100%. Like realty, it is all about location, location, location. You can’t compare DNA if you don’t know where it fits into the genome.
Repetitive DNA is notoriously hard to align because there are many places where the DNA chunks can overlap. For example:
These two chunks could over lap like this:
ATTTATTTATTTATTTATTTATTTAGACCCGAGCGG
CCGAGCCATTTATTTATTTATTTATTTATTTA
like this:
ATTTATTTATTTATTTATTTATTTAGACCCGAGCGG
CCGAGCCATTTATTTATTTATTTATTTATTTA
like this:
ATTTATTTATTTATTTATTTATTTAGACCCGAGCGG
CCGAGCCATTTATTTATTTATTTATTTATTTA
There is no one unique way in which those two sequences align, so they are unaligned and kept out of a comparison between species.
I haven’t looked at the videos yet, but I am confident that they are clear enough. I thought I would try to explain the issues in my own words to see if that helped.
That is incorrect. Sequence is excluded because it isn’t aligned, not because it is different. Those are two different things. Think of it as having 3 pieces of a jigsaw puzzle that fit together, but you don’t know where in the larger jigsaw puzzle those 3 pieces fit. That is what unaligned sequence is. There may even be a 100% match between sequence that is not aligned in the chimp sequence and aligned sequence in the human genome, but those comparisons are not made because the chimp sequence is not aligned.
If we are talking about whole genome comparisons, it does become a bit complicated. How do we determine what is orthologous, homologous, paralogous, or novel? Why do they list the differences due to substitutions separate from indels? Comparing specific genes or specific sequences is a lot easier if we are discussing which conclusions or theories the evidence supports.
The only overarching theme I can really point to is that if you use the same method to sequence the genomes of humans and other apes and the same methods for comparing those genomes you will find that chimps share more DNA with humans than they do with other apes. If chimps, gorillas, and orangutans are in one group as determined by DNA, then humans are also in that group due to the pattern of shared DNA. Creationists tend to avoid this point.
