In selling, especially IT, one obtains all questions, reservations, fears, objections up front, answers none of them, unless they’re really easy and even then, and says that one will report on all of them and that can all be discussed at the next meeting. One needs the appropriate process. But that assumes that the party one is selling to is actually in the market. Which isn’t the case with ideological combatants.
1 Like
With all due respect, that wasn’t clear from your post. But if you only had the forum in view then I am happy to concede the point. 
Thanks, @jammycakes. “Magic shibboleth!” I’m going to have to hang on to that one.
Yeah. The dishonesty is real.
Thanks for the suggestions.
And the encouragement.
Thank you, Dale.
MSM is also much narrower, too, than is acknowledged in these types of “discussions.” After a while, it seems to consist of “any resourses outside of my hand full of favorite, idiological spefic ones.” I should probably start asking for lists of allowed resources.
It’s also interesting to hear what people assume I read/hear for information. I reply, “No, I never listen to that, because I know their reputation for being skewed in this or that direction. It’s a deliberate choice to self-censor.” Then they expand their concept of what comprises MSM.
[a side note, I keep accidentally typing “MSU”. Habit, I guess.]
1 Like
You nailed it!
You also have a deep understanding of the literal (rather than metaphorical) process that state employees and state government offices endure, when working with our IT department. They regularly tell us, for example, that our databases, that they wrote, are out of date and must be rewritten. Then the process you describe begins. But there are numerous staff changes as well, which brings the process back to step one numerous times.
Once someone finally, actually writes the code and submits the miserable sembelance of a database to us, and says “Just ask you described,” we have to send it back, so that it actually functions and begin at step one yet again, but this time with “database bias” or “code pollution” in the way of a clear understanding of what we, the clients need.
One might question whether these processes are somehow the elements of Worldwide IT Conspiracy, or if you’ve worked in government, with it’s rather universal roll of red tape.
(By the way, do you prefer to be addressed as Klax, Martin, something else or not at all? Thank you.)
Happy to be Martin, Kendel : )
1 Like
The best approach is to ask the person what evidence they are basing their certainty on, and then try to understand that evidence. If there are holes in their arguments then it will be found in the evidence. Simply complaining about how certain they are won’t do much good. Dismissing the evidence out of hand is even worse.
Someone dared to suggest to me
“Physician heal thyself”
Which might be fine, but you not only show your evidence, you demand that I interpret it the way you do.
I show you evidence and it is either:
Not relevant
or I am mistaken in my analysis of it.
Richard
Well there are rules about how evidence can and cannot be interpreted. This should be obvious: if there weren’t, then you would be able to say that mermaids were evidence for a young earth, because treknobabble.
The evidence has to actually exist, for starters. It has to be exactly as you describe it. And your interpretations have to be mathematically and logically coherent and consistent.
2 Likes
But that is exactly the kind of calls an expert in their field gets to make. That’s why they are an expert.
If I Google some symptoms and go to my doctor telling them I have fibromyalgia and they determine that what I actually have is a headache and sprained ankle, they are absolutely within their rights to tell me my understanding of the evidence is wrong.
4 Likes
And you have to use mathematics to prove it?
What happened to the application. The manifestation of the DNA? The results in Nature? How does mathematics impinge or dictate any of this? It cannot!
And this is where your precious proof fails. It is theoretic, it is not empiracle You cannot trace the changes you claim must exist. You cannot prove that the interim DNA patterns are viable or exist. You cannot even prove what the comparisons are matching in terms of what the DNA code means or does. You have a mathematical proof. Nothing more, nothing less. And last time I looked Mathematics could only imitate chance, it cannot duplicate or even prove it beyond doubt.
So do not criticise me for doubting.
Richard
I think you need to look into how genetic comparisons are done, Richard. I think you’ll find that it is a very rigorous and mathematical process. It’s also fairly cutting-edge technology that’s only come to the fore in the past twenty years or so.
Have you ever tried running genetic comparisons using BLAST for example?
1 Like
I rest my case.
Richard
Goodnight…
Not at all. What we should reach agreement on is the description of the evidence. For example, if a forensic scientist argues in court that a DNA sample has specific alleles we should at least agree that we are seeing the same data. When someone says there is a nested hierarchy it doesn’t help when someone misrepresents a nested hierarchy as nothing more than similarities.
The first step would be understanding the difference between a claim and facts. Evidence is a set of facts. Claims are not facts.
Once we agree on what the claims are and what the facts are, then we can discuss which analyses are correct.
Math is what we use to analyze the data and test our hypotheses.
Here are two sequences:
ATTGCGGCTTAAAATGTGTA
ATTGAGGCTTAAAATGTGTA
----*---------------There are 20 bases in both sequences. They differ by 1 base. Empirically, they are 90% identical. Can you explain why this isn’t empirical?
Are you certain?
Let’s use a murder investigation as an analogy. A forensic scientist (FS) goes to the murder scene and finds a corpse with a knife sticking out of his chest. The FS finds hair samples at the scene, and after some tests the FS is able to isolate DNA from two people, one of whom is the murder victim. The FS is also able to find bloody fingerprints on the knife, one set of which does not match the victim. The FS is also able to find shoe prints, tire prints, and clothing fibers. The fingerprints lead investigators to a suspect, and at the suspect’s house they find shoes with the victim’s blood on the sole, and a match between the sole prints at the crime scene. The tire prints match the suspect’s vehicle. Clothing at the suspect’s house is covered in the victim’s blood. The suspect has no alibi, and also has strong motive for killing the victim.
Would you consider this to be enough proof to convict the suspect of the crime? Or would you need a video tape of the suspect committing the crime in order to convict?
Because it is mathematics. it is not Biology.
Is not a fair comparison of what you are trying to prove.
So, using your own arguments. We cannot agree that the data or argument is relevant
I do not dispute the use of DNA for human familiar matching. I do dispute cross-species matching.
But apparently you see no difference
Richard
Applied mathematics analyzes and quantifies the processes of nature. If you do not understand this, or perhaps more aptly, do not accept this, then it is hopeless to hold a fruitful conversation. Your development from a fertilized egg has been governed by gradients of pressure, biomolecular and chemical signaling which can be mathematically modeled. The incidence of mutation can be statistically examined. Population genetics, ecology, epidemiology, and predator prey relationships can be modeled by differential equations. Math applies no less to biology than to physics. Quantitative testing is what distinguishes truth from error, the correct qualitative ideas from those which are misbegotten. As in all of science, without math we are flying blind.
It does not demonstrate or prove anything.
And we all know that statistics proves nothing. Statistically the Lottery willl never be won., certainly not as often as it has been.
Is a mathematical exercise!
Where is Nature in all this? Where is the practical demonstration of all this theorising and Mathematics?
This “cutting edge” has never been tested or proven beyond the theory. It self tests, nothing more.
All this just proves my assertions that Evolutions starts from a small proven fact or theory and then extrapolates it beyond the ability to test and confirm. It applies to the whole theory and it applies to your precious hereditary theories. There is no actual evidence that what you theorise does exist or can even exist in macro Nature (creatures and ecology).
Richard
What??? Are you saying we can’t count things in biology?
Also, you didn’t answer the question. Can you tell us why you think DNA sequences and sequence comparisons are not empirical?
At a minimum, we should at least be able to agree on what the DNA sequences are and the differences in DNA sequences.