No it is I who need forgiving for slipping into snark. I don’t dislike you but it surprises me that you actually think scientists should pay more heed to the abstract than to the empirical. It also seems a little unkind to suggest they lack capacity for the abstract merely for choosing to emphasize the empirical where that is what the field requires. I find much of science challenging to follow, and it is the abstract nature of the concepts that make it so. I do feel it would be more honest to admit it isn’t any deficit on their part but your own attachment to the idea that a plain reading of the Bible is preferable to one requiring more nuance. I’d think your esteem for the abstract would make that the more interesting path of interpretation.
I don’t wish to appear judgemental or to claim that the abstract is better or wore than the empirical. nor do I intend insult when claiming a lack of understanding or abiltiy. Like many things, they are just different. I might suggest that if you have a tendency to look at things in an empirical way you might not value the abstract. That would also be an observation.
There might be a bit of one-upmanship involved when I use abstract arguments in an empirical environment whereby the scientists have been claiming superior knowledge and position.
However it does seem to me thst there are certain abstracts and repercussions of the Evolutionary theory that are missed because they are not looked for or valued, that might affect the immutable nature of the theory. It also seems to me that the cohesion of a theory should take into account the repercussions and practicalities involved in applying it when declaring it to be “law” (Scientific linguistics accepted/excepted.) Which almost certainly involves the abstract.
Richard
Or maybe it is a little like religion where you have to commit to a path?
Somehow I doubt they’d be taking that tack if it were a theological point you’d wanted to debate. When the topic the choice of weapons is proscribed. If you want to argue based on something other than science - as I most often do too - I’d pick a topic other than what is empirically true. Frankly I wish you would make an abstract argument for why a plain reading of the Bible is superior while arguments regarding science should be more flexible.
Formal university study of a subject does tend to give one knowledge. I assume you go to doctors who went to medical school?
No scientific theory is immutable. Theories can be revised as new knowledge comes to light. Not liking a theory doesn’t count.
But I don’t think that it is!
I argue against literalism and simplicity. in Scriptural interpretation.
Richard
Sorry but to all intents and purposes, Evolution is. That is how it is taught. That is how it is referenced.
If it looks like a duck, walks like a duck, talks like a duck, it probably is a duck.
Richard
But then why not evolution? Do you infer hard and fast empirical knowledge being handed down in the Bible? I can’t see why. What if the world that God creates and the people (ourselves included) that He creates is the one we experience in every moment. There is so much going on that we are merely the passive beneficiaries of. Who is to say that wasn’t the message we were intended to receive? Personally, I’m not bought into the Bible in any thorough or important way so this makes perfect sense to me. i don’t expect anyone with a satisfactory link to whatever this is to trade down to what I have. Enjoy your community and the shared details which having invested in that book brings you. You’ve earned it. It just isn’t the only way to tap that value.
Not on my planet. And even if you had 20 professors teaching you that dogs glow in the dark and have flippers, that would be wrong also.
What does that even mean?
Are you now saying that DNA is not responsible for the physical shape and function of an organism?
We don’t need to know that in order to compare the sequence of bases in each genome.
Does a forensic scientist need to know the function of the DNA he is sequencing in order to test for a DNA match?
That’s like saying that you have not seen a dinosaur because the picture is a T. rex.
No one is saying that coelocanths are dinosaurs.
That’s like saying there is a debate about the shape of the Earth because Flat Earthers exist.
………… 
Believe it or not, that is the impression I get in conversation with Richard. A point he has so far refused to discuss. I believe his analogy is DNA is just building blocks.
Aw shucks, there was I thinking you had understood me.
When I have time I will respond to each comment (Including the one you quoted). But I have to work now.
Richard
Er, um. Not empirical. In a court of law, circumstantial means that it may or may corroborate but it does not actually prove it.
In terms of abstraction they are similies. DNA forms the basis of growing the ctreature, whther is the actual block or the means of making them does not matter, They form the foundations of the creature. Which is why, in terms of abstraction, the hereditary claim is ludicrous.
A string of DNA forms the code for amino acids. it will be the same code every time. And amino acids are the basis of all life. So they are bound to be there! You are comparing like to like and claiming that one must come from the other when , in fact, they are a necesity! You are comparing the code for bones with the code for bones. An eye for an eye, a tooth for a tooth (oops wrong sort of quotation)
It is the difference between analysing by scientific principle and analysing by abstraction (philosophically) You don’t do philosophy so you won’t see it that way.
See above. If you don’t know what the sequence means then you do not know what you are comparing. You may just be comparing the fact that it has a bone structure, or worse, the one above, the formation of the basic bricks of all life.
You are not comparing like for like. forensic analysis is not interested in anything other than an exact (or family) match.
(Although I admit, neither are you, but that is not the point here)
An Ostrich is not classed as a dinosaur. A T-Rex is,
I was taught they were, but who cares!
Wrong again. Although the abstraction here is a little less easy to define.
Flat earth and spherical earth are two sides of a single argument.
Even if birds are in a direct line from dinosaurs they are not classed together Scientifically (or otherwise) The usage is not scientifically sound.
I trust I have answered everything. You do not have to agree of course, but these are my answers and why I state them. As such they should not be ambiguous or inconsistent.
Richard
I’m glad you’re giving some apparent or grudging acknowledgement of corroboration at least! You do realize that nobody except mathematicians actually formally prove anything, right? But there is a level of ‘proof for all practical purposes’ at the far end of a large ‘corroboration continuum’. And that expanse stretches a long ways from ‘unconvincingly circumstantial’ to ‘we bet our lives on this one because it is so-well corroborated by so much evidence.’
But corroboration is all you have. In a court of Law that would not be enough. Why should science accept it enough to declare something as certain?
Richard
Well - yeah … evidence is all we have. And lots of it. Courts of law act on evidence all the time. If absolute proof was always demanded then no criminal could ever be successfully prosecuted.
DNA sequence comparisons are empirical.
How do you determine if scientific evidence is circumstantial?
What do you mean by foundations?
I would describe DNA as a template for chemical reactions. It is the interaction between DNA, RNA, proteins, and other biomolecules that produces the end product.
Most organisms on Earth don’t have bones, so why would DNA for bones be a necessity? Also, why would there only be one or similar DNA sequences that produce bones? To use another analogy, Google Chrome browsers look identical on both Macs and PCs, but the underlying computer code is different for Macs and PCs. The same applies to biology. It is entirely possible to have two nearly identical organisms that have very different DNA sequences. For example, if you changed the anti-codons on tRNAs you could have very different DNA sequences that produce the very same amino acid sequence in proteins.
Really? I can produce a random string of 25 bases, copy it, change one base in the copied sequence, and then compare them.
TTGGTCAAGTGATATCCTGGTAAGG
TTGGTCCAGTGATATCCTGGTAAGG
------*------------------
Are you telling me that I those sequences aren’t 96% similar because they don’t have a function?
That’s false. Forensic analysis is interested in non-matches. A forensic scientist doesn’t have to know the function of the DNA he is using for analysis, nor does the DNA need to have a function in order to determine heredity since non-functional DNA is also inherited.
Yes, it is. All birds are classified as theropod dinosaurs.
http://tolweb.org/Theropoda/15726
I highly doubt that. Coelocanths are fish.
Birds are scientifically classified as dinosaurs.
Sorry but this does not compute.
DNA controls you growth.
Your DNA comes only from your parents. Hence it is an indication of your heredity.
What is the “hereditary claim” that you are disputing?
I am disputing long distant comparisons of heredity, not parents or even grandparents. I am disputing comparing the DNA of a Mammal with the DNA of a fish to prove heredity (I can’t work out how wide these connections are but to be of any use {to Evolutionary theory} they would have to be between species that are not otherwise connected.)
I am saying that DNA is the basis of all life so there has to be similarities regardless of any direct hereditary connection. It would be ludicrous if the DNA sequencing was unique to each creature. DNA sequencing is the key to understanding life, not Evolution (and they are not similies)
Richard
PS forgive me if I am getting short-tempered and therefore a bit curt)
DNA might be considered “similar” but it is never identical. And it is often the differences that can indicate heredity.
What about the same broken gene that humans and chimps share?
And you have never responded to the +100,000 ERV insertions in the human and chimp DNA. They serve no function, except for the original virus that inserted itself into our genome, so there is no reason for them to be there. Pretty sure you don’t think humans and the other apes share a common ancestor.
That didn’t come through you answer at all.