An example of the type of gene change used for phylogeny:
Nearly all members (that have been checked) of Buccinoidea, Muricidae, Olivoidea, “Turbinelloidea”, and Conoidea share TTTACTGGTGCGTCGGCTGCGAGCGT in the earlier part of their 28S genes. Most other caenogastropods have a CG instead of the bold GC.
The gene is producing part of nuclear ribosomes in pretty much all animals. Why does that change only appear in a large subset of gastropods that also share a siphon, fairly frequent large size, have similar radular morphologies, and are macrocarnivors (except for columbellids), if they are not actually related?
Oh I do. If I want to build a bridge across the English Channel can it be done? Yes. You start at one side and construct piers that reach the sea floor. Add the road deck and then construct another set of piers that reach the sea floor. Repeat until you reach the other side. What would prevent me from building piers long enough and strong enough to reach the sea floor? Sure the really tall piers might be a fancy piece of construction but it can be done. In fact the new piers will bare a strong resemblance to the previous piers. Almost like they had a common ancestor. But what would prevent me from doing this?
Klax
(The only thing that matters is faith expressed in love.)
202
And what would it have to do with God as revealed in Christ or not?
Never saw a Be Smart video before but it is well done and suitable for all ages. But I doubt it or anything else will move the needle for someone who has decided to endorse and promote alternative facts. We seem to be living in a post facts, post expertise world now. There is very little I’d choose to discuss with anyone who holds such a WV.
If you are asking about my last post then nothing.
Klax
(The only thing that matters is faith expressed in love.)
206
Not your post per se. That conversation. Where do we draw the line between unwarranted belief and reason? It’s different for all of us here obviously. For some unwarranted belief comes before reason, or heads it off at the pass. For others they go in parallel; separate magisteria. We’re all Humean here, including me: reason is, and ought only to be, the slave of the passions. What passions?
No, you don’t. You have just illustrated the wrong notion. I used the Atlantic because it was less likely. You used the Channel because it has more likelihood. It was even considered I believe.
The point of the analogy is not what can be achieved but the fact that bridges have limits.
TOE relies on certain “proofs” that it works. But these examples are both very recent, and very limited in scope. TOE seems to think that nothing is impossible. The analogy shows that the impossible does exist and therefore can be considered.
Really? In my example what kinds of limits? With unlimited funds and material the bridge could certainly be built.
And for your going to the moon problem. Did we just build the Saturn V and go? Or was there a long slow evolution of rockets from the first Chinese solid fuel, to the first liquid fuel, to the Saturn V. Was there anything that prevented that development? In the days of the V-2 people might scoff that we would ever make it to the moon but in looking back we can see that we did.
Not really, but many things are possible when you take small incremental steps (see building bridge across the English Channel). The problem is in what YOU consider to be impossible. Evolution looks backwards in time to see how the present was accomplished. Winning the lottery could be considered an impossibility until you meet a winner.
Arguing by analogy isn’t an exact science but you have done nothing to show that the impossible is actually impossible and not just highly improbable.
No one will ever build a bridge over the Atlantic let alone to the moon. The resources alone do not exist. You must distinguish between theory and practice. In the practical (real) world the impossible exists.
Evolution despite certain scientific linguistics, is still mostly theory. IOW there can be the possibility that in practice (reality) it either did not, or cannot, do what it claims. To just dismiss this is either arrogance or short-sighted, I am not sure which.
It has been repeatedly pointed out that evolution is constrained, and a great deal is indeed impossible. Your objection here is wrong in that you are ascribing a belief that is not held. Given that point has been made several times, it is past due that you acknowledge that evolution predicts nothing of the sort. Evolution is not teleological, and it can only adapt from existing forms and material, which is why phylogeny is powerful evidence. Please respect what others are actually saying.
Agreed. Even were it physically possible, it may not be remotely practically possible. But nothing existing in nature is akin to any impossible engineering task.
And the basic notion of microbe to human may well be the exception that proves your rule.
Richard
Klax
(The only thing that matters is faith expressed in love.)
212
So how did we get here? With nothing but evidence of dysteleology at every scale? If not in one hundred trillion generations of the immortal germ line, all using the same chemistry; electron transport down iron-sulphur cluster respiratory chains? Without the confluence of endosymbiosis? If not from the warm alkaline vents away from the mid-ocean ridge black smokers?
Yes, order out of chaos. That always seems to be a stumbling block that is glossed over. All signs are that decay is the direction that Nature takes, but Evolution builds. The world ecology and interdependency defies all ideas of random chaotic construction. But because that involves meteorology and other branches of science, Evolution does not have to take notice of it. However, it does have to take notice of Ecology.
White corpuscles working independently yet still under the influence of the body to call them to the right place. They function to the benefit of the body without obvious cognition or understanding. Plants that depend on bees or other organisms to spread and multiply. Birds that clean ticks off other creatures (similar instances in fish. The cycle of life that needs death to sustain it. And the ability to keep some sort of harmony despite humankind’s continued attempts to disrupt or destroy it for human gain. I wonder how interspecies co-operation could possibly evolve in creatures that have no cognisance or understand the logic of it. The invention of language including such things as bee communication that has been so accurately understood. These things are beyond the scope of Evolutionary study, but are still a direct consequence of what it claims to achieve.
The reason I talk of abstraction and consequence is that, it appears that, Evolution takes no notice of it, as if it is completely irrelevant. Yet in many ways abstraction is a verification process. It proves you understand what you are saying in the wider setting of reality and existence, not just within the confines of theory and observation.
Richard
Klax
(The only thing that matters is faith expressed in love.)
214
What stumbling block? Order emerges from ‘chaos’ from the beginning and constantly ever since and before in the eternity of beginnings and never implies meaning.
Evolution is a theory, but a very well supported theory. It is the best explanation for the diversity of life we see now despite any misgivings you personally have with it.
So until someone can show an actual limit on the process the theory stands.
No it is just the scientific method. Any theory will stand until a better theory replaces it. And even then sometimes the old theory is still used if it produces useful results (see using Newtonian physics to pilot space probes).
Which puts us back to a flat earth. Here it is not the validity of the theory completely, but the extent (or limitations) that are (or should be) questioned. No one is claiming that the whole of evolution is false, not even me. I only claim that it is not, and cannot be, the whole answer to the creation or development of humans. (abiogenesis excepted/accepted)
And yes, I claim that, as it stands, there are places in the overall theory that are physically impossible, within the parameters of Evolutionary change. Now if you can find the proverbial spaceship to enhance certain changes… (Ie a different method of change that can change complex and interdependent features in one go)
Something that is not required despite what you think. Your understanding of feathers for instance.
You must have forgotten, but I firmly believe in the Intelligent Designer, just not in Intelligent Design.
T_aquaticus
(The Friendly Neighborhood Atheist)
219
Gravity is a theory. Germs are a theory. Atoms are a theory. The highest any idea can get in science is theory. I guarantee there are thousands and thousands of scientific theories that you accept as true.