I see that you need some explanation, since there are some fundamental misconceptions in your arguments. If you type randomly, then there is no information in your string. But at the time that you (an intelligent person) decide that this string is a password, this string contains information. And when you (an intelligent person) make a password stronger than occurs by chance (which you say, is possible…), then this string contains information, added by your intelligent decisions.
The second misconception is that you think that encryption transforms information into noise. No, information is not deleted. The information is only hidden, The sequence seems to be noise for the persons that don’t have the tools to read it, but for the aimed persons, it is essential information.
Any sequence of letters or DNA or anything else is information. Making a random sequence of letters be a password makes it useful information for one purpose. Making it be a word makes it useful information for another; for example, a science fiction writer was playing Scrabble and decided that feghoot would be a fun name for a character. But in a basic information theory sense, the sequence itself is information. As all possible DNA sequences have potential function, they all are useful information of some sort. Not all DNA sequences are actually functional, and some have function not strongly related to their sequence (such as spacer regions). But those DNA sequences could function (either positively or negatively) if directly transferred into a context where they were being read.
Thus, vzhj is information. It is a particular sequence of letters - it exists. It is not the same as zvhj. It takes up a certain amount of computer memory. Likewise, AACACTCTATATTTTATTTGGAATATGGTCTGGACTAGTTGGAA is information. It tells a particular kind of snail how to make part of the cytochrome oxidase I protein. Change any of the bases, and that’s new information. It probably still tells how to make part of cytochrome oxidase I. But it would work just as well as a part of billions of other proteins. A few changes, and most deletions and insertions, would make it not work as directions for cytochrome oxidase I, but transposed into another setting it would be usable for some other protein, and the RNA could be used for gene regulation even with such modifications.
Although intelligent design is about willful intent, information is generated by falling raindrops, by crystal growth, by gravity, and every other unintelligent process. The Bible sees all processes as ultimately directed by God; however, ID claims often assert that processes that follow natural laws without additional intelligent direction can’t produce information. That is untrue. Likewise, both YEC and ID often fall into the error of promoting atheism by claiming that natural law processes imply a lack of God’s direction. For example, “you are either created by God or by mindless molecular processes” is a catchy slogan but terrible theology. You are individually created by molecular processes, whether we think about the processes of conception and growth or the constant ongoing processes of metabolism. None of those molecules has a mind. The reality is that God created us, making however much use of mindless molecular processes that He wished to. We can use science to examine the evidence of what physical processes were used in creation.
Don’t forget Leviticus 25 with the sabbath year. By your reasoning, the days of Genesis 1 must have each been a year. But then you get to Lev. 25:8, where the Hebrew describes the year of jubilee as following a “day” of 49 years. Seven symbolizes perfection and completion. Saying that God created in 13 days would convey the message that creation was cocked up. But the form of Genesis 1 strongly matches other ancient Near Eastern writing that describes perfect completion and isn’t really talking about chronology at all.
It is not the designer who cocked up His revelation, but rather the flawed interpreters who are at fault. “Enlightenment” deism to atheism put excessive reliance on human wisdom and on “scientific” approaches (which often were not actually well-rooted in data but instead represented an imposition of an assumed pattern on the evidence). William Miller, having been a deist, took the “I can figure it all out for myself” approach to the bible and popularized it in both the US and England in the first half of the 1800’s, which led to the “Great Disappointment” when his predictions of the second coming failed to occur. However, some of his followers continued the disregard for the wisdom of others while developing interpretations to claim that something big theologically did happen in 1844, or to develop alternative dating systems. One of those developing another interpretation was Ellen White. Thus, the Seventh-day Adventist approach builds on the errors of deism. Of course, you can’t remain in the SDA if you question White’s claims, but you should recognize that others are likely to not accept that her interpretations are inerrant.
It is the insistence that Genesis 1 must be interpreted as a literalistic and scientific account that supports naturalism and discredits the Bible. Reading the passage in light of its ancient Near Eastern context gives both theological insights and the understanding that everything is under God’s control and part of His design. The sea and its great beasts are chaos monsters, rivals to the gods, in the surrounding cultures. Who knows what might happen if one of the gods gets cranky or oversleeps? But Genesis 1 affirms that the sea, the great beasts, the sun and moon, all are just stuff that God made, with no plans or goals or rivalries of their own. Thus, we can expect the creation to behave in an orderly manner. Likewise, humans are given a special role as caretakers of creation. We can’t do that unless we can understand how it behaves and the effects our actions are going to have. Thus, Genesis 1 gives excellent reason to believe that science works and that we should indeed pursue it.
In turn, science helps us to understand the Bible and to choose between possible interpretations. We can recognize figurative statements based on whether or not they match with our knowledge of the world. Just as understanding the Bible requires an understanding of the language it is written in (including good translations), it also requires an understanding of the basic workings of the world. We recognize the resurrection as significant because we know that it is not the normal outcome for someone to be alive again a few days after being killed. We can figure out how to apply the principles of the Law to modern situations such as traffic by using our knowledge of the physical processes coupled with the ethical principles of the Bible. The Bible is one of the most important sources for history of the ancient Near East, but its focus is on providing theological lessons, not on giving all the details that a historian would want to know. It uses various figures of speech and selects illustrative examples, passing over other information that did not serve its purpose. In other words, it is reliable, but careless interpretations are easily mistaken.
I believe you guys are talking past one another. You’re using a standard definition of ‘information’ relevant to Shannon information theory, while @Vanengelen is talking about information as meaning, which implies a semantic definition of information. The latter is a perfectly legitimate way of thinking about information – it just doesn’t apply to DNA sequences.
Yes I get that, but the string itself hasn’t changed. The only thing that has changed is what it is used for. Nothing has been added to it and nothing has been taken away. Therefore, to claim that it didn’t consist of information originally but it consists of information now doesn’t follow.
There’s something else you need to understand here. Information is a property that is mathematically well-defined and measurable. People who claim that new information cannot be created have to admit that it is not Shannon information that they are referring to but some other form of “information”—but they never clearly define it in mathematical or measurable terms. If you can’t say how it can be measured, then you can’t say whether it can be created or not.
Yes! You are perfectly right! Thank you. Why do you think that the Shannon definition is applicable to DNA and the semantic definition is not?
You wil not be surprised that I have the opposite opinion. DNA, the language of God. No language without semantics.
Because it can be produced randomly.
Except that it can be produced randomly without evidence of intent or design.
Truly, you are a God who hides himself, O God of Israel, the Savior.
Isaiah 45:15
Shannon information theory has some pretty obvious applications in the mathematical treatment of DNA modeled as a string of symbols. Semantic theories of information are generally not quantitative (at least in my poorly informed impression). More seriously, they typically treat information in terms of the referents of symbols and in terms of resulting mental states, neither of which applies in any obvious way to DNA.
But DNA isn’t a language. As I wrote before, it’s a molecule. Language involves abstract symbols that represent something else, symbols that can be presented in different ways and via different media. DNA just interacts chemically. If you represent codons in some other medium, they don’t mean anything. (If you really want to treat ‘language of God’ as something other than hyperbole, you’d have to treat all DNA, including supposedly random mutations, as having meaning, since presumably God is responsible for all of it.)
You can meaningfully inquire about whether a particular stretch of DNA carries functional information (as has already been pointed out), but that question can be asked without reference to ‘meaning’ and can be answered without reference to semantics. And by that standard, random changes to DNA can certainly increase the functional information present.
Well, we disagree here. DNA is not the language, OK, it’s the structure that carries information using a coding system. We call such a thing normally a language. It has semantics and a syntax. The codon is the abstract symbol. The same information can be presented in different ways. We can type it, It is transcribed and translated. We can understand the meaning or purpose. If we present codons in another medium, for instance when I type it here, or when a colleague of me has a tattoo of it (which really is. Nice one), it is meaningful. We know the purpose of codons.
DNA just interact chemically, that is true, but the same is true for all information-carriers. Oh, no. it’s not true. DNA interacts with brainprocesses. How, other do you think that information in our brain is stored, if it is not in differences in gene-expressions of our neurons?
For me, it’s OK to speak of “functional” in stead of “meaning”. And the chance that random changes to DNA increase the functional information (for me, that is tautological) is extremely low.
Yes!
For that matter, darkness was regarded as an enemy of creation that the gods had to fight every night in order for the sun to come back.
= - = + = - = † = - = + = - =
That’s such a sensible point it seems obvious . . . once it’s been made. ![]()
Since it’s been sequenced, I suppose you could make a string of words indicating what each section we understand means (e.g. “pigment”, “hair”, “lymph”, etc.) with a lot of “yada yada yada” where it means nothing and “blah blah” where it’s functional but we don’t know what it does. But that would be a mighty heap of word salad, so while it might be “language” it would be nonsense.
It seems to me to be hopelessly complicated to deal with whole DNA as Shannon information, because it’s an incredibly complex “random” variable.
In terms of new “functional” information, this article has helped me:
To me, the fact that DNA exists and operates speaks of a wise and awesome Creator. But, I haven’t seen an argument about “irreducible complexity” that hasn’t been plausibly explained by evolutionary biologists. Of course, this isn’t to say that God didn’t miraculously intervene at times in the evolution of life. But, I suspect that if He did, it would be in ways that our finite minds could not fully grasp.
In the field of mathematics we have had to accept that in a reasonably powerful formal system, there are true propositions that can be neither proved nor disproved within the system. See the Incompleteness Theorems of Kurt Gödel - Wikipedia
It wouldn’t be hard for me to believe that there are parts of the development of life that can be neither proved nor disproved with the known rules of Evolutionary Biology.
From the ‘struggling’ conversation: “I am biologist and I see irreducible complexity everywhere I look in biology”
St.Raymond: “I’ve never read of a claim that stands up to scrutiny”
This seems like something a person might say if they had lost their place, so to speak. There are surely things we can all be certain of in a scientific sense – I am quite certain that I will need oxygen, fuel, and a heat source to start a fire, for instance — but given the weight of the topic, your statement seems to imply a certainty of a different kind. Or perhaps it’s merely a statement of fact; perhaps you haven’t delved into the subject too deeply and are simply unaware of any meaningful observations or the history of particular problems.
We as a species have discovered a little over 90 different kinds of naturally occurring atomic matter in the universe, along with just a handful of laws they follow in their interactions with one another — and it would appear we’ve done quite well with that knowledge. We’ve split the atom, discovered a quantum world, and have instruments that allow us to observe enormous distances across the cosmos. We’ve not discovered anything resembling biology (life) anywhere but on this planet, and there isn’t a biologist or anyone else in the world that can explain (in a scientific sense) how that came about from those few material elements and laws.
As the history of discovery clearly demonstrates, the living cell functions by rate-independent control of a rate-dependent process, and no one has resolved (or even come close to resolving) the core problems surrounding the physical implementation of that control. This is an implementation that requires irreducible complexity; a physical reality that was not only predicted and confirmed (1948, 1955, 1956-58, Von Neumann, Crick, Hoagland, Zamecnik) but also highlighted by the fact that we require two complimentary descriptions of the system — one for the rate-dependent aspects of the system and another for the rate-independent aspects.
(The most obvious example of this latter description is the Genetic Code itself, describing a set of relationships between the spatial orientation of bases in condons of DNA and the specification of amino acids in a protein. As predicted, these critical relationships are established by rate-independent memory).
Hi @appsandorgs – welcome to the forum.
We’ve really only been able to inspect (parts of) our own solar system for life to date, and of the places we’ve been able to look, only Earth and possibly Mars could host life anything like ours. So our failure to discover life elsewhere tells us just about nothing about the frequency with which life occurs.
Could you expand on what you mean by rate-dependent and rate-independent here (rate of what?) and why it matters?
You seem only to be addressing the origin of basic cellular machinery, i.e. the origin of life. That’s an interesting subject but not really relevant to the discussion in this thread, which is about the appearance of irreducible complexity during the course of evolution.
I can’t think of any other use of ‘language’ that is that broad. Human languages express mental states, while computer languages connect mental states to machine instructions. In case, what word we use to describe DNA should not matter.
Sure, for us abstract codons have meaning. We’ve created that abstraction. That’s not a feature of DNA as a molecule acting within a cell, however – we can create similar abstractions from all sorts of naturally occurring things.
Once again, I agree: we can (in principle although not in practice) provide a strictly materialist description of how DNA acts in cells and of how spoken English acts on human neurons and how raindrops interact with the soil and so on for every other causal chain of physical phenomena. In doing so, however, we will have dropped any notion of ‘meaning’; our description will involve only interacting particles and fields. We can frame the description in terms of information if we like, but if we do we’re back to the original issue: raindrops carry information just as DNA does.
Here’s the nub of the matter – everything else is just semantics. This is your claim. I assume you’re restricting it to large increases in information, or increases that specify complex structures, since it’s trivial to show that random changes can lead to functionally useful phenotypic changes. My question is, what evidence is there to support that claim?
We won’t even have a decent sample size until/unless we explore other star systems with “goldilocks” planets.
I didn’t specify, but you’re right about what I had in mind. We don’t know enough about abiogenesis to even have a discussion about it. Personally I think it’s one of the seven interventions that university friend of mine said God had to make to get humans, but that’s not even an educated opinion at this point since I haven’t looked into the topic for three decades.
Or at least functionally useful, something I’ve seen happen in my flower bed – a species that’s normally quadraploid had some offspring that turned out ocataploid, which increased the number of blossoms by a factor of four and changed the shape of the stem. Unfortunately of the three plants, two died (thanks to dogs deciding they were good for peeing on) and the third didn’t have any offspring despite the astounding number of seeds (roughly ten per blossom, with thirty blossoms on each side for a hundred twenty, so ~1,200 seeds).
Hello. This wasn’t making a judgement about the “frequency with which life occurs” — it was simply a statement of fact.
Nothing obscure was intended. “Rate-dependence” simply refers to the dynamic properties of matter. In physics, if object A interacts with object B, the outcome of that interaction will be determined by natural law — that is, by the exchange (the rate of exchange) of energy between the objects. In practical terms, rate-independence means that the equations that a physicist would rely on to explain and describe material outcomes cannot be used to explain or describe the existence or make-up of the observed relationship between a codon and an amino acid, for instance.
Your comment only makes sense under the mere assumption that the origin of life (or Darwinian evolution) can occur without irreducible complexity. Darwinian evolution occurs in a self-replicating cell that contains encoded memory and translation machinery to interpret that memory in order to control (specify) what is to be replicated. The capacity to specify something among alternatives from encoded memory requires irreducible complexity. Again, this was predicted and confirmed in the 1940s and 1950s, and has been thoroughly described in the literature.
The observations aren’t even controversial.
I can’t figure out how this relates to his point that the origin of life isn’t the topic here.
Where does this apply to the topic?
St.Raymond,
The commenter just told me that the topic of the thread is “about the appearance of irreducible complexity during the course of evolution.”
But Darwinian evolution itself requires irreducible complexity in order to function as it does. If A requires B in order for A to exist, then A cannot be the source of B.
That would seem rather pertinent to the topic.