Is H. Sapiens the only intelligent species on the planet?
The interesting question is how can the sequence of nucleotides be considered specified (the S in CSI)?
That the nucleotide sequence specifies an amino acid sequence is not disputed anywhere, but the critical question is how is it that nucleotide sequences can be regarded as specified.
Manuals exist for a reason, and they’re not hard to find.
Not necessarily, there may be many intelligent species. The point is we only see intelligence create CSI.
This is getting off the original response to @Gregory, but the specification is due to the fact that as far as we can tell, the nucleotide sequences that create functional organisms are very sparsely populated in nucleotide space. Down the line we may discover on the contrary somehow the sequences are not sparse, or evolution is highly guided to hit these specific squences. In the former case, the CSI is only illusive. In the latter case, evolution itself is packed full of guiding CSI, which in turn needs to be explained. In either case, the ID argument remains valid, only the premises may no longer be sound, so neither possibility damages the logical structure of the argument.
“If you’ve read any of Dembski’s writings…” - EricMH
C’mon, Eric, please work harder at playing fairly. You are aware that I attended the Discovery Institute’s summer program, just like you did. Yes, I’ve read not a few of Dembski’s writings over the years, even obscure ones.
“all his [Dembski’s] examples of intelligent design involve human designers.” - Eric MH
That’s simply false.
“the important issue you raise distinguishing human and ‘transcendent’ (for lack of a better word) design” - EricMH
No, that’s not “the important issue” I raised. Please check again. The available “better words” for communicative accuracy in science, philosophy, theology discourse, imho, when facing IDists, are the terms “Divine Design” (aka uppercase “Intelligent Design”). Otherwise, you’re just putting your own preferred vocabulary on what I wrote, thus turning a dialogue into a monologue.
Simply framed, I asked you about making a distinction between “Divine Design” and “human design” in the context of “design universalism” (the ideology that everything is “designed” and there is nothing that can properly be called “not designed” due to the “play of scales”). You have not, at least that I’ve seen so far, addressed this anywhere near successfully or clearly, which is why I invited you to instead ask your employers, Stephen C. Meyer and John G. West to clarify their own position(s). Again, why not ask them, and convey their answers, not just yours, here, EricMH?
Quite a significant communications problem that could be easily solved still now persists with the IDM and the DI double-talking, using the same terms to speak of “Divine Design” and “human design”. This needs to be cleared up. Will you help clear this up by taking ACTION in contacting Meyer & West to convey their explanation for the DI’s language policy on this “important question” (as you called it)?
“The jump from #2 to #3 is what used to trip me up, and I suspect it may be what is fueling your criticism.” - EricMH
No, it’s really not. I’ve moved past such “arguments” that you are now constructing in your own mind. You still seem rather tripped up and confused. My criticisms are largely fueled by the unsubstantiated, grandiose, and occasionally flat-out false or at least badly misleading claims made by several leaders of the DI & their Fellows, about “ID theory”. When the DI closed their ID for SSH summer program after John G. West spent a week with me in his classroom at SPU, since he realized that any “ID theory” in the social sciences and humanities was practically IMPOSSIBLE (because redunant, low in meaning & value in most potential applications), this was a step forward in shrinking IDism to a more manageable size. But sadly, EricMH, you have never addressed this, and apparently didn’t get the memo about the demotion of “ID theory” from SSH, and so haven’t learned that lesson, along with most other IDists yet.
Let me try another route, in case you may show integrity instead of avoidance following its lead. It happens that just a couple of weeks after I met Behe, Miller & Larmer at the end of last year, I also bumped into Denyse O’Leary for a similarly brief but fascinating encounter. You do know Denyse and have also spoken with her, right, EricMH? She is the journalistic “News” staff for the Bradley Center’s Mind Matters, where you are employed, as well as for other DI-funded projects. So I mentioned to her about having spoken recently with Behe, Miller & Larmer (apparently no one invited her or let her know about the event in the city where she lives!) & that they didn’t answer my questions about the distinction between “Divine Design” and “human design” in the context of “design universalism”. She thought that was odd.
Then I asked what she personally thought about the important distinction. She was a bit perplexed at first, but then responded: “I should think in principle its possible”, i.e. to distinguish between Divine Design and human design. The only thing was, she couldn’t do it! At least she had the integrity to admit what Behe & Miller just expressed stupification at being asked.
So here’s the thing: she works where you work, EricMH. You’re officially “colleagues” at Mind Matters. If you can’t/won’t get an answer from Meyer or West about it, couldn’t you at least publish something together with her there, finally addressing “Divine Design” and “human design” in the context of “design universalism”? Wouldn’t it be better for your own inner peace to know you’ve actually faced this challenge head-on, rather than time and again running away from or ducking it?
It has genuinely become obvious that the Discovery Institute is hiding their duplicity on this very issue in plain sight. The early-20s host (had asked the questions to all participants on stage) and student organizer of the event mentioned above, who ended up in a small group discussion with Miller, Behe & I after the event, realized this quite quickly it. The DI spokespersons simply make a leap of logic/grammar/dialectic, and pretend nothing has happened. It’s a “Poof!”-like issue for “ID theory”, and one that the IDM, including folks like yourself, EricMH, a former student of the DI’s summer program, now employed by the DI, really need to rethink in their hearts to stop obfuscating.
So, in short, will you ask Meyer & West, Eric? If not, why not? Why keep coming up short? This a thread about the supposed “Academic persecution of ID proponents”, right? It would benefit dignified dialogue if you could get an answer from Meyer & West, after all this time. And if not, will you write & make a proposal to publish yourself or with Denyse O’Leary on Mind Matters about it? Again, if not, why not, since it would seem to be well within the purview of your employee mandate at Mind Matters?
At the end of the day, if you’re in real life a guy who’s trying to help people, EricMH, who’s trying to lead people to the glory of God and in service to salvation of fellow human beings, and not just to propagandize to them with ambitious (revolutionary!) quasi-“scientific” jargon and ideology, could you not please step up to the plate in good faith?
Why do you ask?
As always, I affirm my faith in an intelligent designer, even as I question ID as a scientific/mathematical enterprise.
All species that communicate and/or use tools are creating and propagating CSI, in my opinion. So the creators of CSI include:
In fact, I’m hard pressed to think of a vertebrate that does not acquire CSI from interacting with peers.
My point is that evolution has produced intelligence in abundance. Thus I reject the the claim that CSI is so rare that its appearance can only be attributed to superior intelligence.
In addition, nucleotide sequences are clearly influenced by inheritance, mutation frequencies, and selection. You have not cited any examples of CSI that arise by the mechanisms of biological evolution, therefore it is a category error to draw a comparison between biological evolution on the one hand and a book, radio signal, motorcycle, or transistor on the other.
Huh?
You can find biologists who possess a religious belief that evolution is dysteleological, but the theory is not inherently dysteleological. Teleology vs. dysteleology is a philosophical-religious question, and neither stance is incompatible with the theory of evolution, which takes no position on teleology.
Is a rock teleological or dysteleological? The question doesn’t even make sense! A rock might sit in the middle of stream and become smooth from erosion, or it might get picked up by an Egyptian vulture that wants to crack open an ostrich egg. In the erosion case you might argue that the rock is dysteleological; in the vulture case you might argue that it has a purpose (the one given it by the vulture). Whatever purpose that rock has would be exogenous, however, not intrinsic.
I suggest that it is no more sensical to speak of evolution being teleological or dysteleological than it is to speak of a rock being teleological or dysteleological.
Blessings,
Chris
All life has CSI, it’s a synonym for it. And Chris, in a cosmos that wants for no design, what did your intelligent designer design?
Surely CSI doesn’t stand for crime scene investigation but I’m drawing a blank.
But you have yet to give any justification for that expectation – it’s certainly not my expectation. For example, and has already been pointed out, natural selection combined with the genetic code will yield a periodic structure to the observed substitutions, one with a period of 3 bases. This structure will be much more apparent in you’re looking at gene-rich DNA like mtDNA.
Complex Specified Information an expression taken up by Creationists, especially Dembski, from true science.
Let’s start here. Here is a DNA sequence. Please measure its CSI.
cgtgagggctccggaccttgactattatgtcctcgatcaagctttcccctagggaccgta
cgtcttgcgtcgatacctccagccccagcaagttcttgtaagccgtatagggacactctt
ctccattacgatcctcctacctgcggcgcgatgctagctcgagagtattaggtccccttc
ggaagccatgactaatcgtagacgttcttacaaccgtcttatgatttgcattggccggta
cgaatcgagtttatgttgatgtgaatctcaatttctgcaggcaaggcaggaatatttcac
cgcccttggcgaggttgtcctcgcattgaaaggaagaactctcacttacctacttgtccc
atttagcgtatcttttcactctcctctaagccgtaagacgtcccccggacctgctaattt
taccgggttaattgagaaactcccaacagcgccctacaggcgtcttcgagtagaataggg
ccgggggattcgtggtgtatgtcaggattagacttcgattgccgctcgagaacgaagacc
atcccaaccacacgttctaggtccaaacttccggcagctaccgccctcactccacttttt
gtgaccaaattaggcccccacctcgaattagctcttcttacatgcttatctctgtagcct
tgcccagctttattctcgtcgttgcaacgggtcagtaaaactctcgctttttatggcaag
aaggaaaatcatcggttacactcgcggggttctacggacatccaatgtaggacggtcaag
tgtgaatttttccatcatactacttttcgcggtcctcccgacgtcaaagctaactccctc
agatcctcgttacgaacctagcgcgacgctttcttacgttgtaatagacccgcttgatgt
acaacacgcttaagactcactacggctcgcttgtgaccccgagggctcgtcatccgccca
ctgtacgccgcgctcccgaccggaataagacctaatccttI agree with @glipsnort. We would expect non-random distribution of mutations when comparing functional DNA between species. Selection is a real thing, as is third base wobble. Exons and introns are a real thing.
Notice how the 100 vert. cons track (measures sequence conservation across 100 vertebrates) has spikes of sequence conservation (i.e. fewer mutations) that align with the exons.
It’s under Definition, Orgel’s terminology.
I can more easily understand a particular character in a DNA sequence getting pinned by a selection effect, e.g. Dawkins’ weasel program. However, distant correlated characters getting pinned by selection is harder to understand. While a single character getting pinned is possible with an incremental increase in fitness, correlated characters may have to co-occur for an increment in fitness. A linear increase in the number of necessary co-occurring characters means a super linear decrease in probability.
Let’s look at this mathematically.
For the single match case, say the probability of a match is P, and matches occur independently for N characters. So, the probability of randomly assembling a sequence and not having any matches is 1-P^N. This means the longer the sequences the better chance we have of gaining in fitness and making evolution happen. Sounds like evidence for undirected evolutionary theory and a trend to increasing complexity. Exactly what we evolutionary theorists like.
However, say all the matches have to occur simultaneously for the N characters in order to get a fitness increase. The probability of getting a fitness increase by randomly assembling a sequence becomes P^N, which exponentially trends to zero as N increases. The more this has to happen, the less likely undirected evolution can occur.
What I see with the correlated mutations is more like the second case than the first case.
As you know, you need to provide two more elements for me to make that measurement. You need to provide the probability of that sequence happening according to evolutionary theory, and you need to provide the functional specification. Until you do that, I cannot measure CSI.
The interesting thing in your links is that the expression “Complex Specified Information” was invented by an evolutionary theorist and origin of life researcher, not a creationist or an IDist.
Like all ID arguments, they have their origin with secular scientists researching evolution and the origin of life. None of it comes from creationists. Which is why ID is solidly based in science, not religion.
The problem is you are not distinguishing between creating and propogating CSI. All of the creatures you’ve listed have stayed static in the CSI they propogate. If you see the CSI in gorilla behavior today, it will be exactly the same as the CSI in gorilla behavior X years ago. Only humans can properly be said to create CSI, i.e. new things that have never before occurred in the history of humanity.
Then furthermore you make the leap to ascribe the CSI in the animal kingdom to evolution without any evidence, thus begging the question.
Yes, evolutionary theory is inherently dysteleological. That is what the random in random mutation means. The changes that occur happen entirely without any kind of guidance.
Now, the changes that stick around are pinned by natural selection, and we can call that portion teleological insofar as it adds a directing force to evolution. But it is not a helpful kind of teleology, and in the grand scheme is still ultimately random. As Wolpert makes clear in his paper on free lunches in co-evolution:
However, in the typical coevolutionary scenarios encountered in biology, where there is no champion, the NFL [no free lunch] theorems still hold.
Relevant section from the paper:
For example, say the problem is to design a value y that maximizes a provided function g(y), e.g., design a biological organ that can function well as an optical sensor. Then, even if we are in the general coevolutionary scenario of interacting populations, we can still cast the problem as a special case of Example 1. In particular, for our design problem C does not involve any “subsequent game against an antagonist,” so C is independent of f. (Just like in Example 1, C only depends on f indirectly, through the characteristics of the population produced for f. Unlike in self-play, there is no direct dependence on f in C.) Similarly, we can restrict search to never be revisiting.
Due to the fact that they’re a special case of Example 1, the NFL theorems hold in such scenarios. The extra details of the dynamics introduced by the general biological coevolutionary process do not affect the validity of those theorems, which is independent of such details.
Well, you’ve spent much more time with John West and others at the DI than I ever have, so trying to contact them through me is unlikely to produce any new insight than you’ve already received. Despite the appearance that I’m some sort of DI shill, I’ve barely had any interaction with the majority of the people at the DI. The only person I’ve had sustained contact with is Dr. Marks, and he’s only interested in the mathematics of ID, not any of the sociology, so interacting with him will unlikely provide you any insight. Believe me, I’ve tried discussing philosophy and such with him, but it is a dead end 
I have to say – what are you talking about? The vast majority of the mutations you’re looking at – within or between species – consist of neutral mutations. No one has suggested that positive selection should impose long range correlation in the mutations seen. We’re telling you that purifying selection should that have that effect because selective constraint is periodic in coding sequence.
As the second link shows, which I emphasized later, Orgel brilliantly differentiates between specified simplicity - crystals - complex chaos - aggregates - and specied complexity - life. Without superfluously mentioning information.
“Let your conversation be always full of grace, seasoned with salt, so that you may know how to answer everyone.” -Colossians 4:6
This is a place for gracious dialogue about science and faith. Please read our FAQ/Guidelines before posting.
